article_id
stringlengths 8
11
| article_text
stringlengths 513
1.04M
| document_type
stringclasses 4
values | domain
stringclasses 3
values | language
stringclasses 22
values | language_score
float32 0
1
|
|---|---|---|---|---|---|
PMC10250731
|
Coronary arteries disease without significant flow-limiting lesions or severe coronary vasospasm can result in an acute imbalance between oxygen demand and supply, causing acute myocardial infarction with non-obstructive coronary disease (MINOCA) ( 1 ). In 2019, the American Heart Association's practical guidelines and algorithm were established to provide clinical guidance for the diagnosis and treatment of MINOCA ( 2 ). Misoprostol, a prostaglandin E1 analog, is currently used under the recommendation of the National Institute For Health and Care Excellence 2019 and the American College of Obstetricians and Gynecologists 2020 for the termination of pregnancy ( 3 , 4 ). However, misoprostol uncommonly can induce acute coronary vasoconstriction when used with a high dose ( 5 ). Herein, we report a case of a 42-year-old female suffering from acute STEMI due to severe coronary vasospasm following the administration of high-dose misoprostol for abortion induction. A 42-year-old Vietnamese female (gravida 5 para 3) with a past medical history of hypertension reported taking Mifepristone 200 mg to induce the termination of her 5-week pregnancy one day before admission. The patient continued to take misoprostol 600 mcg sublingually one hour before hospitalization. She then experienced acute severe left-sided chest pain, dyspnea, and nausea prompted her to go to the hospital. Upon arrival, the patient noted bradycardia with a heart rate of 55 beats per minute and hypotension with a blood pressure of 70/40 mmHg. The other vital signs were stable, with a respiratory rate of 20 breaths per minute and saturation at 99% on room air. ECG showed 2 mm ST elevations in II, III, aVF, V1, V3R, and V4R with reciprocal depressions in I, aVL, and V6 . Laboratory findings were remarkable for markedly elevated hs-troponin T (103 ng/l). Since the presentation suggested acute ST-elevation myocardial infarction (Killip I) of the inferior and right ventricle, the patient was started on loading dual anti-platelet therapy and statin. Thirty minutes later, she reported that her chest pain had improved. Repeat ECG showed normal sinus rhythm with a heart rate of 70 beats per minute and complete resolution of ST-elevation. The subsequent coronary angiography revealed normal coronary without flow-limiting lesions . IVUS of RCA showed no evidence of significant stenotic lesions, thrombus, or dissections . Transthoracic echocardiography revealed a preserved ejection fraction of 68% without wall motion abnormalities or other structural heart diseases. Troponin level also decreased to 74 ng/L after 3 h of hospitalization and normalized after six days. The patient satisfied the criteria of MINOCA following the Fourth Universal Definition of Acute Myocardial Infarction with the elevated dynamic change of cardiac biomarker, ST elevation on ECG, and the result of coronary angiography without significant obstructing lesion ( 6 ). Due to the correspondence between the pharmacologic characteristics of Misoprostol and the clinical manifestation of patient, we assume the MINOCA is possibly caused by coronary vasospasm induced by misoprostol ( 6 ). She was eventually discharged with calcium channel blocker, beta-blocker, and statin. The patient remained asymptomatic and hemodynamically stable during her follow-ups in 30 days, 3 months, 6 months, and 12 months after discharge. About 6% of patient with acute myocardial infarction is diagnosed with nonobstructive coronary arteries by coronary angiography ( 7 ). Myocardial infarction with nonobstructive coronary arteries (MINOCA) is considerably confirmed when there is no evidence of other etiologies at the time of coronary angiography. A definite diagnosis usually requires extensive workup for various pathologies. Montone et al. reported 46% of patients with MINOCA responded to provocation testing, confirming coronary vasospasm ( 8 ). Coronary vasospasm is defined as an intense constriction of coronary arteries resulting in a significant imbalance between oxygen demand and supply. This phenomenon can provoke severe myocardial ischemia, acute myocardial infarction, or sudden cardiac death ( 1 ). The incidence of this disease varies significantly among races and between countries such as Japanese (24.3%), Taiwanese (19.3%) and Caucasian populations (7.5%) ( 9 ). Dr. Myron Prinzmetal first described this condition in 1959 and reported 32 cases of vasospastic angina (non-exertional chest pain) ( 1 ). The classic diagnostic criteria require a normal coronary angiography with spasm response to a provocative test ( 10 ). Various pathologic mechanisms were proposed, including the direct effect of catecholamines, inflammation, dysfunction of endothelial cells, smooth muscle cell hypercontractility, or increased oxidative stress ( 10 ). Compared to classic angina due to atherosclerotic artery disease, vasospastic angina induced by coronary vasospasm frequently happens in young female patients without significant cardiovascular risk factors ( 11 ). Moreover, typical precipitating factors for this condition include cold exposure, mental stress, stimulants, and medications, such as sympathomimetics and vasoconstrictor agents ( 10 , 11 ). The cardiovascular events or adverse effects of misoprostol were summarized in Table 1 ( 5 , 12 – 21 ). Prostaglandin E (PGE) analogs have both vasoconstrictor and vasodilator properties ( Supplementary Image S1 ). This medication has a long history of adverse cardiovascular effects. PGE2 analog, such as Sulprostone, has been reported to have severe cardiovascular complications such as acute myocardial infarction, cerebral ischemic stroke, and severe hypotension ( 18 , 22 , 23 ). Among the PGE1 analog, misoprostol in combination with mifepristone was approved by the European Medicines Agency for treating incomplete abortion and miscarriage, while Gemeprost was used with caution due to the risk of severe adverse cardiac events ( 5 ). The cornerstone mechanism of these complications was the various effect of Prostaglandin E receptors (EP), including EP 1, 2, 3 and 4. While EP 1 and EP 3 induce vasoconstrictors, EP 2 and EP 4 have substantial vasodilator properties. PGE2 analog stimulates all 4 four receptors, while the PGE1 analog activates only EP 2, 3 and 4 ( 18 ). The selective activation of PGE1 explains these agents’ less frequent and severe cardiovascular complications. According to the prevailing hypothesis, it is widely believed that misoprostol exhibits a dose-dependent effect on the elevation of Norepinephrine (NE) levels. Consequently, the increased NE levels are thought to induce pronounced vasoconstriction and contribute to the occurrence of cardiovascular adverse events ( 24 ). In patients with medical history or high risk of cardiac disease, misoprostol was recommended to be used at a very low dose of 25 mcg every 4 h in combination with prior Mifepristone 200 mg to limit cardiovascular complications for induction labor ( 26 ). Despite being commonly used in obstetrics and gynecology practice for labor induction and considered generally safe, misoprostol still carries a potential risk of cardiac adverse effects. In this particular patient, the Naranjo Score yields a score of 7 out of 13 points, suggesting a moderate likelihood of misoprostol being responsible for the observed cardiac adverse events ( 5 , 22 , 23 ). On the other hand, misoprostol at higher doses is typically used for terminating a pregnancy, yet evidence of its safety is still unclear. WHO recommends that a single dose of misoprostol 400 mcg should be given orally within 24–48 h after taking mifepristone to induce medical abortion for less than 7-week pregnancy. Additionally, besides the dose, the route of administration can impact the process of absorption, bioavailability, and the concentration of active compounds in the bloodstream ( 27 ). Misoprostol is usually administered by several pathways, including buccal, sublingual, vaginal, oral, or rectal. Among various routes, a sublingual pathway has the highest peak of plasma drug concentration while the vaginal with water has the most prolonged time of adequate drug concentration ( 25 ). So theoretically, the risk of adverse events is highest in these two administration pathways. Thus far, there are no definitive criteria to diagnose Misoprostol-induced coronary spasm. In our case, the patient with risk factors for coronary artery disease exposed to Misoprostol 15–20 minutes before the onset of chest pain suggested a probability of association. Additionally, the plasma concentration of Misoprostol peaks at about 30 min and declines rapidly by 120 min if used orally ( 25 ). This pharmacokinetic can explain the resolution of chest pain and normalization of ST-T changes on ECG shortly after hospitalization. Moreover, the diagnosis is more consistent with coronary vasospasm when the following angiogram and IVUS exclude occluded coronary arteries. The dynamic changes of cardiac biomarkers, ECG and clinical symptoms of the patient suggest the diagnosis of MINOCA possibly due to coronary vasospasm induced by misoprostol. New imaging modalities such as optical coherence tomography and cardiac magnetic resonance (CMR) can be used to clarify the underlying pathologic mechanism. CMR plays a crucial role in the diagnostic evaluation of patients with MINOCA, as it is recommended for excluding non-ischemic cardiac causes including cardiomyopathies, myocarditis, pericarditis, and Takotsubo syndrome. CMR has been found to be useful in confirming the diagnosis in up to 74% of cases ( 6 ). However, further investigation of this case is challenging due to our limited facilities.
|
Clinical case
|
biomedical
|
en
| 0.999996
|
PMC10256566
|
The cutaneous manifestations typically associated with IE are Janeway lesions and Osler nodes - nontender macules or papules on the soles and palms of the feet and painful immunogenic skin lesions, respectively. Other manifestations of IE include splinter hemorrhages, which often manifest as painless erythematous lesions in the nailbed . Rarely, cutaneous necrosis can form as complications from septic emboli from the underlying IE . The underlying histology of these lesions tend to be micro-emboli with abscess formation that may eventually grow the underlying organism when cultured . Common organisms that cause IE-associated cutaneous skin infections include aerobic and anaerobic organisms, namely Staphylococcus aureus and Bacteroides fragilis . Mixed cutaneous necrotic infections, such as those with superimposed herpes simplex virus type II (HSV-II) infection in the setting of an immunosuppressed patient with IE, can further complicate the disease course. Understanding the underlying pathophysiology, risk factors, and clinical presentation of cutaneous necrosis associated with methicillin-resistant Staphylococcus aureus (MRSA) and Bacteroides with superimposed HSV-II is crucial for timely diagnosis and management of this rare, potentially life-threatening condition. A 47-year-old Caucasian female with a past medical history of systemic lupus erythematosus (SLE) and antiphospholipid syndrome (APS) on chronic anticoagulation therapy presented to an outside hospital for shortness of breath and significant dyspnea on exertion. A transesophageal echocardiogram (TEE) there demonstrated findings consistent with severe mitral valve regurgitation and focal thickening of the anterior leaflet of the mitral valve. Given her autoimmune history and initial negative cultures for bloodstream infection, there was some suspicion for Libman-Sacks endocarditis. There was additional concern for an active SLE flare and catastrophic antiphospholipid syndrome (CAPS); therefore, the patient was treated with steroids, intravenous immunoglobulins (IVIG), and plasmapheresis. On transfer, she was evaluated by the cardiothoracic surgery service, who postponed immediate mitral valve surgical replacement given her severe thrombocytopenia with overall pancytopenia. Her hospital course was complicated by a variety of infectious processes, including bacteremia caused by Klebsiella oxytoca, Enterococcus faecium, Klebsiella pneumonia, Cytomegalovirus (CMV), Epstein-Barr virus (EBV), as well as possible CMV colitis. She was placed on cefepime, daptomycin, and intravenous ganciclovir. The patient began to develop cutaneous lesions consistent with splinter hemorrhages and Janeway lesions. Repeat blood cultures were negative - though this was in the setting of multiple days on broad-spectrum antibiotics. A repeat TEE was ordered which re-demonstrated the mitral valve thickening previously seen from the outside hospital's TEE along with mildly dilated left atrium, and a left ventricular ejection fraction of 55%. As the patient had persistent fevers, vascular phenomenon, previously positive blood cultures from other organisms, and echocardiographic abnormalities, there was now increasing concern for infectious endocarditis since that fulfills three or more of the DUKE minor criteria for infective endocarditis. CT-angiogram of the aorta with intravenous contrast demonstrated new tiny focal hypodensity in the left common iliac artery, possibly representing thrombus/embolus. There was also, of note, a focal wedge-shaped hypodensity of the posterior spleen suspicious for developing infarct. CT of the chest demonstrated new bilateral soft tissue pulmonary nodules, greater in the lower lobes, that were suspicious for septic emboli vs. metastatic disease. The cardiothoracic surgery service was re-consulted, given these new findings, and ultimately postponed surgical intervention to the mitral valve citing her significant comorbidities, thrombocytopenia, and her being too high risk for intra- and post-operative complications. An erythematous lesion was noted on the dorsal aspect of her right wrist on hospital day 8 . There was initial concern that this was secondary to her arterial line, which was recently removed, or cutaneous necrosis secondary to her underlying IE. The dermatology service performed a punch biopsy of this lesion and histopathology demonstrated numerous gram-positive bacteria in the deep dermis on Grocott methenamine silver (GMS) and periodic acid-Schiff (PAS) stain. Additionally, there was deep abscess formation, necrosis, and hemorrhage present. There were also scattered multinucleated cells with clear nuclear molding and margination of chromatin was identified in the deep dermis, both within the inflammatory infiltrate and within the necrotic vessel walls. These findings were consistent with a herpesvirus infection with superimposed bacterial infection. Immunohistochemistry confirmed HSV-II infection, and bacterial cultures were positive for Bacteroides fragilis and MRSA . The patient was already being treated with broad-spectrum antimicrobials that covered these organisms. Due to the patient's status of being a poor surgical candidate, she was discharged on long-term intravenous antibiotics in hemodynamically stable condition after a prolonged and complicated hospital course. A repeat outpatient TEE one month later demonstrated significant interval resolution of the mitral valve thickening and the patient had significant clinical improvement. This case demonstrates a unique presentation of cutaneous skin necrosis caused by polymicrobial infection, including HSV-II. Bacteroides and MRSA are well-established organisms that can cause necrotizing fasciitis with abscess formation . However, as blood cultures did not demonstrate these species, there is no objective measure of confirmation that these organisms migrated from the presumed seeded valve to the skin. The likely primary site of infectious origin was believed to be from a previous arterial line or peripheral catheter. However, given the patient's systemic septic emboli to her lungs, brain, spleen, and skin findings of Janeway lesions and splinter hemorrhages, cutaneous septic emboli were unable to be definitively ruled out. HSV-II is commonly associated as the leading causative agent for anogenital lesions and is known to reactivate in times of physiological stress and immunosuppression. Cutaneous manifestations outside of the anogenital region usually manifest as herpetic whitlow vesicles . Although rare, HSV-II can cause cutaneous necrosis, as evidenced by a previous case reporting HSV-II nasal reactivation causing necrosis with a superimposed bacterial infection . Other herpes virus families, such as herpes zoster virus (HZV), have also been shown to cause necrotizing fasciitis when superimposed with a bacterial infection . This current case further demonstrates the complexity and clinical challenge of HSV-II regional cutaneous necrosis as bacteria also grew, clouding the picture of a causative organism. This is yet another unique presentation of a cutaneous lesion in the setting of IE, immunosuppression, and acute illness.
|
Review
|
biomedical
|
en
| 0.999998
|
PMC10404129
|
Scleroderma is a condition characterized by excess collagen deposition, causing progressive fibrosis and thickening of the skin and other connective tissues . Systemic sclerosis results in systemic involvement of internal organs, while local scleroderma, or morphea, involves a confined skin area. ECDS is a form of linear scleroderma that translates to "strike of the sword" and is the most common subtype in children . ECDS distinctly appears on the forehead and/or frontoparietal scalp . This subtype of linear scleroderma is often associated with extracutaneous neurological findings such as headaches, seizures, and visual abnormalities . The incidence of linear scleroderma ranges from 0.4 to 2.7 cases per 100,000 individuals and predominantly affects women and children . To our knowledge, calcipotriene monotherapy to treat ECDS in a pediatric patient has not been previously reported. However, a single case report utilizing calcipotriol ointment plus cream psoralen and UVA therapy in two patients with ECDS showed significant improvement in the sclerotic lesions . Here we evaluate the safety and efficacy of topical calcipotriene in a pediatric patient with ECDS and associated alopecia. A 6-year-old African American female presented with a scar on her left forehead, extending to her scalp. The same area had associated hair loss and darkening of the skin. The patient denied pruritus, pain, trauma, loss of sensation, or bleeding in the area. She denied headaches, seizures, or weakness in any part of her body. The scar initially appeared as a hyperpigmented streak on the forehead, which became indurated and scar-like over six months. Since then, the scar has not changed in size, shape, or color. The patient has no significant medical history, denied recent illness, and is not currently using any prescription medication. There is no family history of scleroderma or other autoimmune diseases. Physical examination revealed an otherwise healthy young girl with a 10 x 2 cm linear, alopecic, hyperpigmented scar extending from her left forehead to her frontoparietal scalp with no facial hemiatrophy . The patient's mother denied biopsy at this time. A clinical diagnosis of linear scleroderma (en coup de sabre subtype) was made due to the patient's age, location of the lesion, and clinical characteristics. The patient's mother said she would like to avoid using steroids or systemic agents and asked if any other topical medications could be effective. It was reasoned that a topically applied vitamin D analog could be a safe and effective therapy for localized disease. The patient's mother was instructed to apply topical calcipotriene 0.005% ointment in the morning and the evening to the affected areas. At approximately three months of follow-up, a remarkable lesion improvement was noted, with resolving alopecia, hyperpigmentation, and softening of the affected skin . Although the exact etiology is not fully elucidated, the literature suggests localized scleroderma is a systemic autoimmune disorder with a strong correlation to a family history of autoimmune disease . Several lines of evidence support CD4+ T-Helper cells, and the resultant pro-fibrotic cytokines, including TGF-β, may be involved in the progression of fibrotic changes characteristic of these lesions . The histopathology of ECDS depends on the stage of the disease and the depth of involvement. Generally, more inflammatory infiltrates are seen in earlier lesions, while broad sclerotic bundles and increased dermal thickness are seen later in the disease course . If the scalp is involved, cicatricial alopecia is seen with eccrine gland atrophy and perineural lymphocytic infiltration . Various treatments are available for ECDS, with methotrexate and corticosteroids being the most investigated and efficacious therapy in children and adults . The current treatment of choice for active lesions includes topical and intralesional corticosteroids. Methotrexate is useful in treating acute and deep forms of linear scleroderma and is sometimes used with steroids . Other therapies include lasers, UVA1, mycophenolate mofetil, and vitamin D analogs like calcipotriene . Calcipotriene inhibits fibroblast proliferation and collagen synthesis and downregulates T-cell function and downstream cytokine-induced fibrosis . In our case above, we presented a case of a 6-year-old female presenting with a linear alopecic scar on the left frontoparietal scalp and forehead without associated hemiatrophy or neurological findings. Although the patient did not present with neurological findings, an MRI is warranted to rule out intracranial anomalies . Due to the mother's reservations about using chronic steroids or systemic agents, we initiated calcipotriene ointment. Calcipotriene ointment was safe and effective in treating her lesions, which did not warrant further use of chronic steroids or systemic therapies in this pediatric patient. ECDS is a rare subtype of linear scleroderma that involves the scalp and forehead. It manifests as a linear fibrotic plaque with associated alopecia that affects the forehead and frontoparietal scalp. These lesions may be associated with ipsilateral face atrophy and neurological sequelae. Signs of neurological involvement should prompt an urgent evaluation with a brain MRI. We do not suggest that topical calcipotriene can replace steroids or systemic therapies to treat morphea or ECDS. This case exemplifies that calcipotriene can be efficacious in treating ECDS and should be considered in select patients without associated hemiatrophy or neurological findings. Further genetic and immunological studies are warranted to elucidate the underlying pathogenesis of ECDS. With the paucity of studies demonstrating effective treatment options for ECDS, clinicians are urged to share their experiences and results when treating these patients.
|
Study
|
biomedical
|
en
| 0.999995
|
PMC10502519
|
Chronic idiopathic constipation affects up to 30% of the pediatric population . Also known as functional constipation, it is defined as the accumulation of large, hard stool from infrequent bowel movements that can result in painful defecation and fecal incontinence . It should be differentiated from pathological causes of constipation, including Hirschsprung’s disease, which typically occurs in the first few weeks of life and is diagnosed by the absence of ganglion cells in a rectal biopsy; however, it can be missed during the neonatal period and present as severe constipation later on. The management of functional constipation in the pediatric population includes the use of nonpharmacologic measures such as sorbitol-containing juices and medications including lactulose, polyethylene glycol, and suppositories. Stercoral perforation is a feared and extremely rare complication of chronic constipation more commonly seen in older, bedridden patients. There are very few case studies reporting stercoral perforation from chronic constipation in younger patients . Here, we present the case of a 13-year-old female with a history of chronic constipation that was complicated by rectal perforation and treated by surgical intervention with the creation of a diverting sigmoid colostomy and mucous fistula. A 13-year-old female with no significant past medical history except for chronic constipation presented to the emergency room with severe right lower quadrant (RLQ) pain and obstipation. On arrival, she was hypotensive at 70/30 mmHg and was tachycardic at 110 beats per minute. She had a normal respiratory rate and saturation on room air. The patient was alert but appeared paler than typical according to her mother. The abdominal examination was notable for firmness and tenderness to palpation at the RLQ area. There was no tenderness to palpation in other areas of her abdomen but stool burden was palpable. Bowel sounds were also present throughout. Cardiac, lung, and skin examinations were unremarkable. Complete blood count and metabolic panels were unremarkable with a white blood cell count (WBC) of 10,300 WBCs per microliter. She was administered 3 L of normal saline boluses and started on a norepinephrine drip and a piperacillin and tazobactam infusion. Computed tomography (CT) imaging from the referring institution demonstrated rectal wall discontinuity at the 2 o’clock position with stool leakage and a large stool burden in the descending colon, sigmoid colon, and rectum . There was no evidence of free air. A normal appendix was visualized. The findings concerned for contained perforation of the lateral rectal wall. The patient was urgently taken to the operating room for rectal examination under anesthesia, diagnostic laparoscopy, rectal biopsy, repair of rectal perforation, and creation of a sigmoid ostomy. The rectum was initially examined with a digital rectal examination and anoscopy which demonstrated a 5 mm × 3 cm perforation at the 2 o’clock position on the rectal wall and a 1 cm × 0.5 cm defect of the mucosa at the 6 o’clock position. Given an enlarged abscess cavity seen outside of the 2 o’clock perforation, a red rubber catheter was placed at the site for drainage and secured to the rectal wall with an absorbable suture. On diagnostic laparoscopy, the catheter was not visible inside the peritoneum, confirming that this site was an extraperitoneal perforation. In addition, no intraperitoneal stool contamination was seen. A biopsy of the rectum was then obtained 2 cm proximal to the dentate line, adjacent to the 6 o’clock position. A laparoscopic-assisted diverting sigmoid colostomy was created at the descending sigmoid junction in the standard fashion. There were no complications during the procedure. Biopsy results showed necrotic colorectal mucosa likely from pressure and the presence of normal ganglion cells with no other pertinent findings. Six months after examination under anesthesia, she underwent a scheduled colonoscopy and motility evaluation in preparation for an ostomy takedown that demonstrated colitis in the rectosigmoid region. However, the workup for inflammatory bowel disease, including biopsy, was unremarkable and the inflammation was thought to be due to diversion colitis. A laparoscopic sigmoidectomy during colostomy takedown was performed to prevent recurrence by resecting the redundant colon. She recovered well postoperatively and was discharged home. According to the American College of Gastroenterology, constipation accounts for at least 2.5 million doctor visits per year . Chronic constipation may lead to severe fecal impaction which increases colonic wall pressure and distention and can cause serious consequences such as bowel ischemia and perforation . Most patients with stercoral colitis present with abdominal pain, cramps, and fever, with a history of poorly managed chronic constipation . The most important differential diagnosis to be ruled out for severe constipation is Hirschsprung’s disease, especially in the pediatric population. Physical examination may reveal abdominal tenderness and distension, as well as the presence of stool impaction in the rectum. Stercoral colitis can lead to complications such as perforations and bowel ischemia, in which patients may present with signs of peritonitis, sepsis, or shock . Perforation is an uncommon but fatal complication of stercoral colitis with a high mortality rate of 30-40% . It is particularly rare in children due to the increased flexibility of the colonic wall in children compared to adults. Interestingly, pediatric patients can often present with nonspecific findings or present similarly to appendicitis, such as in our patient with RLQ pain, masking the diagnosis of stercoral colitis and perforation . Thus, early imaging is necessary for prompt detection, accurate diagnosis, and a favorable prognosis in these cases. CT imaging of the abdomen and pelvis is the gold standard for diagnosing stercoral perforation, with extraluminal gas bubbles and abscess formation typically indicating the progression of stercoral colitis to perforation . Stercoral perforation is a rare but serious complication of poorly controlled constipation that can result in sepsis and potentially lead to a lethal outcome. Our presented case involves a stercoral rectal perforation in a pediatric patient due to chronic constipation. This case emphasizes the significance of implementing appropriate treatment for functional constipation, performing a full workup to rule out pathological etiologies of constipation such as Hirschsprung’s disease, and conducting an early evaluation of possible perforation.
|
Clinical case
|
clinical
|
en
| 0.999994
|
PMC10538353
|
The coronavirus disease 2019 (COVID-19) pandemic has been responsible for the deaths of more than 1,000,000 people in the US alone and continues to mount significant challenges to our healthcare system . The development of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccine has been the most effective tool in reducing the incidence, hospitalization rate, and mortality of the disease in the general population . However, as with all medical interventions, it is important to recognize complications and adverse reactions to continuously guide our clinical approach and decision-making. More so in patients with immune dysregulation and auto-immune conditions who usually require a more tailored approach depending on their disease status, co-morbid conditions, and risk for severe disease and opportunistic infections. Herein, we report a case of a dermatomyositis flare-up following the SARS-CoV-2 vaccine and perform a brief literature review on the current state of knowledge regarding COVID-19 infection and vaccination in relationship to auto-immune connective tissue diseases. A 40-year-old Hispanic female presented to the emergency department complaining of shortness of breath, muscle pain and weakness, and skin rash for two days. She had recently been admitted to the hospital six months prior for similar complaints, in addition to hemoptysis. She underwent extensive workup at the time including a muscle biopsy which showed evidence of dermatomyositis and a bronchoscopy which revealed diffuse alveolar hemorrhage. Following with the rheumatology department since then, she had been receiving mycophenolate mofetil, hydroxychloroquine, and prednisone and had been mostly asymptomatic until two days ago. She reported that she received the second dose of the Pfizer BioNTech (BNT162b2) COVID-19 vaccine one day prior to the onset of symptoms. Her other medical conditions included essential hypertension and controlled hypothyroidism for which she was receiving metoprolol and levothyroxine, respectively. She affirmed strict compliance with all her medications. Family history was negative for auto-immune or connective tissue disease. She had a remote smoking history but denied alcohol or illicit drug use. On physical examination, her heart rate was 90, blood pressure 172/93, respiratory rate 20, oxygen saturation 98% on room air, and temperature 98.0. Lung auscultation revealed scattered dry crackles bilaterally. She had bilateral proximal muscle tenderness and reduced strength. Her skin examination showed erythematous plaques over her cheeks, upper arms, and chest, as well as Gottron papules in her hands. Her laboratory investigations, as shown in Table 1 , were significant for elevated erythrocyte sedimentation rate (ESR), C-reactive peptide (CRP), creatinine kinase (CK), and troponin levels. SARS-CoV-2 PCR was negative. The respiratory PCR panel was negative for any other viral infections. Urinalysis was unremarkable. CT scan of the chest with IV contrast showed bilateral patchy ground glass opacities, concerning pneumonitis as seen in Figure 1 . Based on the above findings, the patient was diagnosed with a dermatomyositis flare-up potentially secondary to the COVID-19 vaccine. She was admitted and treated with high-dose IV Solu-Medrol and intravenous immunoglobulin (IVIG) for a total of four days. She showed continuous improvement while in the hospital and was eventually discharged on a tapering steroid regimen in addition to her previous maintenance medications. She remained in stable condition upon follow-up with her rheumatologist in the outpatient clinic after discharge. Dermatomyositis is a rare autoimmune idiopathic inflammatory myopathy that commonly affects women more than men. It usually presents with symmetrical muscle weakness, skin involvement, and elevated muscle enzymes at any age . The exact etiology remains unknown; however, several environmental factors are believed to be a triggering point in a genetically susceptible population, and viruses and vaccines were reported to be among those factors . Vaccine-induced autoimmunity remains a subject of ongoing research; however, the currently proposed mechanisms are vaccine adjuvants and molecular mimicry between the host cell and antigen . The development of the SARS-CoV-2 vaccine has been the most effective tool in reducing the incidence of COVID-19, hospitalization rate, and mortality of the disease in the general population. mRNA COVID-19 vaccines induce a T-cell-mediated immune response to a protein that has been translated from the mRNA which expresses a significant level of immunity . Several case reports have linked COVID-19 vaccines to potential side effects. The most prevalent adverse effects were injection site pain, fatigue, headache, myalgia, chills, arthralgia, and fever. Life-threatening side effects like Guillain-Barre syndrome, myocarditis, and pericarditis were sporadically reported . Inflammatory myositis including dermatomyositis has been reported following COVID-19 vaccination; however, the causal relationship remains an area of research given the rarity of these cases . BNT162b2 mRNA COVID-19 vaccination safety in patients with rheumatic and musculoskeletal diseases is comparable to the general population . To the best of our knowledge, there have been no reports of vaccine-triggered dermatomyositis flare-ups.
|
Clinical case
|
biomedical
|
en
| 0.999996
|
PMC10628599
|
The COVID-19 pandemic has been one of the greatest health crises in history. To limit the spread of the virus, multiple vaccines have been developed and approved. Along with the common side effects, these vaccines also include some rare adverse effects. New-onset autoimmune phenomena after COVID-19 vaccination has been recently reported. Autoimmune hemolytic anemia (AIHA) is an acquired hemolysis caused by the host's immune system acting against its red blood cells . Molecular mimicry, the production of specific autoantibodies, and certain vaccine adjuvants seem to play a significant role in this autoimmune phenomenon . Despite the numerical difference in the frequency of these events, we report a rare case of warm antibody AIHA secondary to the Oxford-AstraZeneca COVID-19 vaccine (COVISHIELD) manufactured by the Serum Institute of India. Laboratory analysis (Table 1 ) showed a hemoglobin level of 4.8 g/dL, a total leucocyte count (TLC) of 7100 cells/dL, a platelet count of 261,000 cells/dL, and a hematocrit of 14.5%. Liver function tests revealed a total bilirubin level of 7.1 mg/dL, with an indirect fraction of 4.29 mg/dL and normal enzyme levels. The urine analysis was normal. The reticulocyte count was 6%, and the corrected reticulocyte count was 4%. Direct anti-globulin testing (DAT) showed 4+ IgG without C3, haptoglobin was <30 mg/dL, and lactate dehydrogenase (LDH) was 2566 U/L. A peripheral blood smear examination showed anisopoikilocytosis with hypochromia, a moderate number of spherocytes, and no sickle cells or target cells. A bone marrow study showed a hypercellular marrow with erythroid hyperplasia and a normal myeloid lineage. The ECG was suggestive of sinus tachycardia. Imaging studies, including chest X-ray and USG abdomen, were both normal, with no evidence of organomegaly. After ruling out possible underlying etiologies for AIHA, such as drug, toxin, viral or bacterial infection, malignancies, and other autoimmune diseases, and given the recent correlation with the COVISHIELD vaccination with positive anti-SARS-CoV-2 IgG antibody titers, the possibility of COVID-19 vaccine-induced AIHA was considered. The patient was started on tab prednisone at 1 mg/kg/day after consultation with a hematologist and received three units of packed red blood cells (PRBCs). Hemoglobin and hematocrit began to normalize within two weeks of treatment, and there was no relapse thereafter. AIHA following the COVID-19 vaccine is a rare manifestation of the disease. For COVID-19, more than 200 vaccines are being developed, including conventional inactivated vaccines, mRNA vaccines, protein subunit vaccines, and viral vector vaccines. Both COVAXIN (an inactivated vaccine) and COVISHEILD (a viral vector vaccine) are readily available in India . In our patient, clinical and laboratory findings were consistent with hemolysis, leading to the diagnosis of AIHA. After excluding all possible underlying etiologies for AIHA and considering the recent correlation with the COVISHIELD vaccine, we assumed the possibility of AIHA following vaccination, which was later supported by the patient's response to oral steroids. COVID-19 vaccine-induced AIHA is seldom reported, with only three case reports so far, all secondary to mRNA-based COVID-19 vaccines . To the best of our knowledge, this is the first time that AIHA has been reported in an exclusive association with the Oxford-AstraZeneca COVID-19 vaccine (COVISHEILD). The direct causal relation between COVID-19 vaccination and AIHA is yet questionable. One theory proposes that it is an autoimmune response due to molecular memory of host antigens causing the polyclonal activation of T or B cells, which cross-react with red cell surface antigens . Post-vaccination AIHA is manageable, and the advantages of immunization can outweigh these rare risks.
|
Clinical case
|
biomedical
|
en
| 0.999998
|
PMC10636534
|
A 24‐year‐old single man from Shiraz, Iran, referred to an ophthalmologist due to bloody tears in his eyes for about 4 months . The bloody tears started after great distress but were not secondary to tears of joy. The patient had a bachelor's degree and was born in Shiraz. He was raised in a high socioeconomic family and lived with his parents. Medical history of hematologic disorders was unremarkable in the patient and his family. Also, he did not report a history of infection, inflammation, malignancy, trauma, contact with chemicals, or taking medication since his problem had started. Besides, a physical examination of the eyes, lacrimal glands, and facial skin was normal. All requested lab data were normal, including complete blood count, prothrombin time, partial thromboplastin time, thrombin time, and bleeding time. Pathologic evaluation of bloody tears under the light microscope showed red blood cells, confirming the diagnosis of hemolacria. Furthermore, the eye cavity and sinuses were reported normal on the computerized tomography scan of the sinuses and lacrimal glands. On the ocular sonography, the anterior and posterior chambers and visualized parts of periocular structures were normal in appearance, with no sign of a definite pathology bilaterally. Considering the normal physical examination and paraclinical data, the patient was referred to a psychiatrist as he had signs and symptoms of severe depression and anxiety. A comprehensive history taken by the psychiatrist revealed that bloody tears started 4 months after the patient had been recruited for mandatory military service. However, the patient did not request an exemption from continuing military service, ruling out malingering. The patient cried during the interview, and the bloody tears were directly observed, ruling out a factitious disorder. His affect was depressed. The patient had restlessness, irritability, and sleep disturbance. He fatigued easily and showed a lack of concentration in the mental examination. He also had no family history of psychiatric disorders. Ultimately, the mental examination resulted in the diagnosis of generalized anxiety disorder and major depressive disorder. Hence, propranolol 20 mg/day and sertraline 50 mg/day were prescribed for the patient, and he was visited weekly for the first month of follow‐up. Based on the patient's report, the frequency and severity of hemolacria remarkably decreased 2 weeks after treatment commencement and completely disappeared at the end of Week 4. As the depressive signs and symptoms persisted, the treatment continued for 6 months, although tapering was started after 4 months. Interestingly, he had no symptoms in the follow‐ups, which continued up to 6 months after treatment discontinuation. The present case report indicates a relationship between hemolacria and psychiatric disorders. As mentioned, the patient was a young educated man from a supportive family with high socioeconomic status. To explain his idiopathic bloody secretion, it can be hypothesized that great distress resulted in the enormous release of catecholamine neurotransmitters, causing remarkable blood vessel constriction. After relief from distress, the blood vessels would dilate significantly, which could cause a rupture of the capillaries. 7 , 8 Another theory is that chronic stressful situations, including depressive disorders, would cause great changes in the immune and endocrine systems. 9 One of the changes is a remarkable increase in blood cortisol levels, which would significantly alter cardiovascular system function, increasing capillary permeability. Therefore, one of the results could be the distressing phenomenon known as a bloody secretion. 9 The present case indicates that pure hemolacria can occur following major psychiatric disorders, which should be considered only after ruling out other possible diagnoses that could result in bloody tears. Our report implicates that in the case of anxiety and depression, treating the patient with a beta‐blocker and selective serotonin‐reuptake inhibitor is effective in relieving the patient's bloody secretion. The strengths of this case report were the complete work‐up to rule out our other causes of hemolacria. However, the weakness of this report was that long‐term follow‐up was not accomplished. Overall, it seems necessary to conduct a large multicentric case–control study to identify the determinant factors of hemolacria in association with psychiatric disorders. Also, physicians should remember that a rare phenomenon such as hemolacria could have a psychiatric basis.
|
Other
|
biomedical
|
en
| 0.999996
|
PMC10736188
|
Laryngeal neoplasms are divided into epithelial and nonepithelial tumors based on their origin. 1 2 Epithelial tumors comprise the majority of laryngeal neoplasms, and squamous cell carcinoma is the most common malignant neoplasm of the larynx. 1 2 3 Nonepithelial tumors are much less common. This category includes sarcoma, melanoma, and lymphoma. Primary laryngeal sarcomas are rare and account for less than 1% of laryngeal tumors. 1 2 3 4 5 They are classified based on their phenotype and histological grade, similar to their soft tissue counterparts. However, the clinical presentation, treatment, and prognosis of laryngeal sarcomas are different. 1 2 3 4 There are few studies of laryngeal sarcomas reported in the literature. 1 2 3 4 5 Despite that, information regarding the clinical features, biologic behavior, and treatment modalities of laryngeal sarcomas is still limited. Herein, we describe an additional four cases of different pathologic types of laryngeal sarcomas, to increase awareness and understanding about these rare tumors, to avoid potential diagnostic pitfalls. A 49-year-old male presented to the emergency department with difficulty in breathing and weight loss for 3-month duration, exacerbated by physical activity. Fiberoptic examination revealed a subglottic fleshy soft tissue mass obstructing 80% of the upper airway. Computed tomography (CT) scan of the neck revealed a soft tissue mass lesion in the infraglottic region at the left side of cricoid and arytenoids cartilage, protruding inside the lumen and compromising the airway . The patient underwent total laryngectomy with left hemithyroidectomy. Macroscopic examination of the resected specimen revealed a submucosal ill-defined tan lobulated mass, occupying the left thyroid laryngeal cartilage that measured 2.9 × 2.5 × 2 cm. Microscopic examination showed a tumor composed of lobules of hyaline cartilage permeating into the adjacent bony trabeculae. The tumor showed mild increase in cellularity as well as cytological atypia, in the form of nuclear hyperchromasia and occasional binucleation . The diagnosis of low-grade chondrosarcoma was rendered. The resection margin was free of the tumor. Postoperative course was uneventful. Five months later, there was no evidence of tumor recurrence or metastasis by imaging studies. A 57-year-old male patient presented with hoarseness of voice for one-year duration. A glottic mass arising from the right vocal cord was found by fiberoptic examination. CT scan of the neck showed thickening at the glottic anterior commissure, with focal submucosal nodular intense enhancing lesion . The patient underwent right anterior cordectomy and debulking of the glottic mass. Macroscopic examination of the resected specimen revealed multiple tan/white irregular rubbery and friable soft tissue fragments, measuring 3 × 1.5 × 0.5 cm. Histopathological examination showed a submucosal tumor composed of fascicles of moderately atypical spindle cells with abundant eosinophilic cytoplasm, marked nuclear pleomorphism, and prominent hyperchromasia. Brisk mitotic activity was noted . The tumor cells were strongly and diffusely reactive for smooth muscle actin (SMA) and calponin, but negative for keratin AE1/AE3, keratin MNF 116, keratin ⅚, desmin, MyoD1, myogenin, S100, and Melan A. Based on these findings, the diagnosis of leiomyosarcoma was made. The resection margin was free of the tumor. Two weeks after the surgery, the patient noticed improvement of his voice. Ten months later, there was no evidence of recurrence or metastasis by imaging studies. A 36-year-old gentleman presented to the outpatient clinic with difficulty of breathing and swallowing for 3-month duration. Fiberoptic examination revealed a smooth mobile swelling arising from the right hypopharyngeal wall causing partial airway obstruction. CT scan of the neck revealed a lesion along the posterior wall of the hypopharynx . Macroscopic examination of the resected specimen revealed a nodular rubbery lesion measuring 3.5 × 3 × 1.5 cm. Microscopic examination showed a submucosal tumor composed of lobules of atypical spindle cells in a prominent myxoid stroma with arborizing chicken-wire vasculature. Other areas showed lobules of adipose tissue separated by thick fibrous septa that contains atypical hyperchromatic spindle cells . By immunohistochemistry, the tumor cells were reactive for CDK4 . By fluorescence-in-situ-hybridization (FISH) analysis, MDM2 gene amplification was detected along with amplification of DDIT3 probe region. Based on the immunohistochemistry and cytogenetics results, the diagnosis of well-differentiated liposarcoma (WDL) with prominent myxoid stroma was rendered. There was no evidence of tumor recurrence or metastasis detected by magnetic resonance imaging performed 6 months later. A 59-year-old ex-smoker, male patient presented with hoarseness of voice, stridor, and shortness of breath for 3 months duration. Fiberoptic examination revealed no obvious masses. CT scan of the neck showed a heterogeneous enhancing laryngeal mass, partially obstructing the upper airway . The patient underwent total laryngectomy with bilateral neck dissection. Macroscopic examination of the resected specimen showed a tan-white irregular mass, located at the glottis, involving the left true vocal cord, and extending to the midline that measures 1.5 × 0.8 × 0.7 cm. Microscopic examination showed extensive infiltration by a malignant neoplasm, composed of pleomorphic and bizarre spindle cells, interspersed by numerous histiocytes . Marked mitotic activity was identified, including atypical forms. A wide panel of immunohistochemical stains was performed, all of which were negative except vimentin. CD68 was reactive in the histiocytic population. Based on these findings, the diagnosis of undifferentiated pleomorphic sarcoma was rendered. The tumor was completely excised. One month later, radiotherapy was initiated. He was followed up at 6- and 12-month intervals and there were no signs of recurrence or metastasis. Laryngeal sarcomas account for less 1% of laryngeal neoplasms. 1 2 3 4 5 Various sarcoma types have been reported to occur in the larynx. Their nomenclature and classification are similar to their soft tissue counterpart. However, there are considerable differences between laryngeal sarcomas and soft tissue sarcomas. The former presents early and are diagnosed at earlier stage. Thus, laryngeal sarcomas have lower mortality and less rate of local recurrence and distant dissemination. 1 2 In addition to that, negative margins are difficult to achieve in laryngeal sarcomas due to the anatomical complexity of the region. Moreover, laryngeal tumors are removed in piecemeal in some cases, which impose diagnostic challenge for the pathologist examining the specimen. There is wide variation in the histomorphologic features of laryngeal sarcomas. Chondrosarcoma is the most common primary sarcoma of the larynx. 1 6 7 8 It has been found that the conventional subtype is the most common; however, other subtypes such as clear cell, mesenchymal and dedifferentiated chondrosarcomas have been reported. 6 7 8 More than 50% of cases arise in association with chondroma component, which makes the diagnosis of low-grade chondrosarcoma more challenging. 1 6 7 Tumor cellularity and nuclear atypia are useful features to differentiate chondroma from low-grade chondrosarcoma, the latter is more cellular, and the chondrocytes demonstrate nuclear atypia in the form of hyperchromasia and irregular nuclear contours with frequent binucleation. Extensive sampling of the tumor is necessary to detect any dedifferentiated component, which is characterized by the presence of high-grade spindle cell sarcoma adjacent to the low-grade component. 1 6 7 Up to 50% of laryngeal chondrosarcomas develop local recurrence, and the risk increases with incomplete excision. 6 7 However, they have very low risk of distant metastasis. 6 7 Therefore, conservative surgery with preservation of the laryngeal function and obtaining negative margins is advocated. In the largest cohort study of laryngeal chondrosarcoma, they found that it has an excellent prognosis with relatively high 5- and 10-year survival rates (88 and 66%, respectively). 8 Leiomyosarcoma of the larynx is much less common. 1 9 It most commonly arises from the glottic and supraglottic regions. 1 9 It is essential to rule out the possibility of sarcomatoid carcinoma before making the diagnosis of leiomyosarcoma. Immunohistochemical stains are useful in this setting; sarcomatoid carcinomas are reactive for high molecular weight keratin, p63 and p40. On the other hand, leiomyosarcoma would be negative for these antibodies, but positive for smooth muscle markers such as smooth muscle myosin, desmin, and caldesmon. 10 Another important feature that helps to distinguish sarcomatoid carcinoma is the presence of dysplasia in the overlying surface squamous epithelium. Patients with laryngeal leiomyosarcoma have been found to be at increased risk for distant dissemination 11 therefore, surgical resection with negative margins, in addition to adjuvant chemotherapy, should be considered. 9 10 Liposarcomas of the larynx are usually well-differentiated, either in the form of lipoma-like or sclerosing subtypes. 12 It is essential to differentiate WDL from lipoma and its variants, such as spindle cell and pleomorphic lipoma. The presence of lipocytes of variable sizes, thick fibrous bands that traverse the tumor, and atypical hyperchromatic spindle cells are features that favor WDL. In some cases, with limited tissue material, the diagnosis is difficult to achieve on hematoxylin and eosin stain. In such cases, the use of MDM2 and CDK4 by immunohistochemistry and/or FISH is helpful to establish the diagnosis. 13 14 Positive staining for MDM2 and/or CDK4 or the detection of their amplified genes by FISH confirms the diagnosis of WDL. 13 14 It is also essential to extensively sample the tumor to rule out the possibility of dedifferentiated liposarcoma, which is characterized by the presence of high-grade spindle cell sarcoma adjacent to the well-differentiated component. 12 It has been found that up to 50% of laryngeal liposarcomas recur; therefore, the current recommendation is to perform wide surgical excision with negative margins. 1 12 Undifferentiated pleomorphic sarcoma (UPS) is a rare laryngeal tumor that arises most commonly from the glottis. 15 It is a diagnosis of exclusion that is made after running a wide panel of immunohistochemical stains and ancillary studies. Sarcomatoid carcinoma is essential to exclude, which is usually positive for high molecular weight keratin, p63 and p40. Dedifferentiated liposarcoma is another possibility that should be considered and ruled out by running MDM2 and CDK4 through immunohistochemistry or FISH. UPS/MFH is an aggressive tumor with high rate of local recurrence and metastasis 16 17 18 therefore, wide surgical excision and obtaining negative margins are recommended. 17 Adjuvant radiotherapy and/or chemotherapy may be considered in large tumors and patients with positive margins. 16 Two cases were published previously separately as case reports. The undifferentiated pleomorphic sarcoma case was published under the title “Glottic Malignant Fibrous Histiocytoma: A Case Report and Literature Review” (Aljariri AA, Alsaleh AR, Al-Enazi HA, Haider HA, Petkar M, Rahman W, Nashwan AJ. Glottic Malignant Fibrous Histiocytoma: A Case Report and Literature Review. Case Rep Oncol. 2021 Mar 31;14(1):641–646. doi: 10.1159/000514977. PMID: 33976647; PMCID: PMC8077659). The WDL case was published under the title “Well-Differentiated Liposarcoma of the Hypopharynx Exhibiting Myxoid Liposarcoma-like Morphology with MDM2 and DDIT3 Co-Amplification” .
|
Study
|
biomedical
|
en
| 0.999997
|
PMC10758454
|
Enteric duplication cysts are uncommon congenital anomalies ( 1 ) that can occur at any level of the alimentary tract, from the tongue to the anus ( 2 – 4 ). They are lined with smooth muscle and mucosal layers, similar to other parts of the alimentary tract ( 3 , 5 , 6 ). According to the human literature, their occurrence is rare but are considered as differential diagnoses for upper intestinal obstruction, especially in infants ( 2 , 7 – 9 ). Clinical signs include partial or complete gastrointestinal tract obstruction, melena, or pancreatitis. However, they can also be incidentally identified ( 2 ). Several theories have been proposed to explain the mechanism of intestinal duplications in association with urogenital anomalies or concurrent vertebral malformations ( 9 – 11 ). However, the precise etiology of enteric duplication cysts is unclear ( 12 ). To the best of our knowledge, this is the first case report describing an intestinal duplication in the ileum of a cat. A 6-year-old castrated male mixed cat weighing 5 kg presented with vomiting, anorexia, and lethargy. On physical examination, the cat was mildly depressed and slightly dehydrated (5%−8%). The complete blood count and blood electrolyte levels were within the normal range. Serum biochemical panel revealed mild hyperglobulinemia (5.3 mg/dl; reference range [RR: 2.8–5.1]) and hypercholesterolemia (274 mg/dl; RR: 65–225). The immunoreactivity of feline pancreatic lipase was unremarkable. Thoracic radiographic examination revealed no abnormalities. Ultrasonography revealed an exophytic, hypoechoic mass adjacent to the ileum. The patient was premedicated for general anesthesia using intravenous butorphanol (Myungmoon Pharmaceutical, Seoul, Korea) 0.5 mg/kg and ampicillin-sulbactam (Whanin Pharmaceutical, Seoul, Korea) 20 mg/kg. Induction was performed after intravenous injection of 4 mg/kg of alfaxalone (Jurox, Rutherford, Australia). Anesthesia was maintained with isoflurane (Choongwae Pharmaceutical, Seoul, Korea). The patient was administered normal saline (0.9%; Choongwae Pharmaceutical, Seoul, Korea) at a constant infusion rate of 5 mL/kg/h throughout the surgery. An exploratory laparotomy revealed a cystic mass originating from the distal end of the ileum, close to the ICJ . The mass was located at the mesenteric border of the distal ileum. Aspiration of the contents within the mass was attempted but failed because of the contents' viscosity. The contents of the mass were removed through a small hole which was created in the mass . Subsequently, the remaining parietal cystic wall was removed subtotally. The cystic wall close to the mesenteric border remained to preserve the blood supply to the adjacent ileum. There was no communication between the mass and the adjacent intestinal lumen. The defect was omentalized by securing the omentum to the serosa using simple interrupted sutures . The abdominal wall, subcutaneous tissues, and skin were closed routinely. Recovery from anesthesia was uneventful. Cytology of the contents was performed but was nondiagnostic. There was no growth of microorganisms. The cat was discharged on postoperative day 3. Histopathological examination of the cystic mass revealed that the mass had smooth muscles in its walls and was lined by a mucous membrane . The mass had typical layers of intestine consisting of normal mucosa, submucosa, and muscularis . The mass also revealed intensely mixed, predominantly chronic, mucosal and mural lymphocytic plasmacytic inflammation, with a modest component of active eosinophilic and neutrophilic inflammation. Based on histopathologic findings, the mass was diagnosed as an enteric duplication cyst. Four months after surgery, the referring veterinarian reported no recurrence of clinical signs. Congenital intestinal abnormalities include diverticula and duplications ( 2 ). Considering that the intestinal diverticulum is usually located on the antimesenteric border of the intestine, communicating with the intestinal lumen, as in the case reported here, the diverticulum was excluded from the differential diagnosis ( 13 , 14 ). Enteric duplication cysts must be located in or close to the gastrointestinal tract and include both a smooth muscle layer and alimentary epithelium ( 8 ). All anatomical components were present in this case. Therefore, the final diagnosis of the mass was enteric duplication cyst. Enteric duplication cysts can occur at any level in the alimentary tract. They can occur at either the antimesenteric or mesenteric border of the small intestine; however, they are generally found on the mesenteric side in humans ( 13 ). Eight previously reported cases have described enteric duplication cysts associated with the small intestine in cats ( Table 1 ). Of the eight cases, five cases of enteric duplication cysts occurred in the duodenum ( 2 , 3 , 5 , 15 , 16 ), two occurred in the jejunum ( 3 , 15 ), and one occurred in the esophagus and duodenum ( 16 ). To our best knowledge, this is the first reported case of an enteric duplication cyst in the ileum. Several theories have been proposed to explain the congenital development of enteric duplication cysts ( 6 ). According to the human literature, Steiner et al. hypothesized that in utero mechanical traction or some vascular events at the proximal side of the diverticulum result in its detachment from the intestine ( 20 ). Regarding vascular events, Favara et al. suggested that intrauterine ischemic infarction is the cause of intestinal duplication ( 21 ). However, according to the veterinary literature, the exact etiology of an enteric duplication cyst has yet to be established ( 12 ). The clinical signs may differ depending on the location and size of the enteric duplication cyst ( 3 , 19 ). Of the eight previously reported cases, five were symptomatic, and the most common clinical sign was vomiting ( 3 , 5 , 16 – 18 ). These are assumed to result from a partial or complete intestinal obstruction ( 22 ). The remaining patients were asymptomatic, and enteric duplication cysts were found incidentally ( 2 , 15 , 19 ). In the case reported here, the cat experienced vomiting due to partial obstruction of the ileum, which resolved after surgical management of the mass. Since abdominal radiography may only reveal a non-specific soft-tissue mass within the abdomen ( 8 ), ultrasonography is the most commonly utilized imaging modality for the diagnosis of small intestinal duplications cysts ( 21 ). Specifically, if a mass has typical features of the alimentary tract, ultrasonographic examination can be helpful for a definitive diagnosis ( 23 , 24 ). CT examination may also help diagnose the cystic nature of enteric duplication cysts ( 4 ). According to the human literature, enteric duplication cysts may be identified on CT as smoothly rounded, fluid-attenuating structures with thin and slightly contrast-enhanced walls in or adjacent to the intestine. According to the veterinary literature, the location of the mass can affect the extent of surgical excision of the mass. In 5/8 previously reported cases of enteric duplication cysts associated with the small intestine in feline patients, surgical management involved subtotal resection with preservation of the adjacent small intestine ( 2 , 3 , 16 , 19 , 21 ). Considering that the mass was located in the duodenum in all five cases, it is assumed that subtotal resection of the mass was performed to preserve the bile and pancreatic ducts. Among the three cases wherein complete resection was performed, the mass in 2/3 cases was located in the jejunum ( 5 , 15 ). However, in the remaining case, although the mass was located in the duodenum, complete mass resection was performed without complications, likely because the mass was located 3 cm caudal to the duodenal papilla ( 20 ). In this case report, subtotal resection was chosen rather than complete removal of the mass because the mass was adjacent to the ICJ. The ICJ regulates intestinal transit, allowing the intestinal contents to move intermittently from the ileum into the colon to ease nutrient absorption. The ICJ also prevents retrograde reflux from the colon into the ileum due to its sphincter properties and the synchronized motility between the ICJ and adjacent intestinal segments ( 25 ). Thus, removal of the ICJ leads to a loss of retrograde reflux regulation, resulting in nutrient malabsorption and inflammation of the ileum due to colonic bacteria ( 26 ). Severe diarrhea, weight loss, and tenesmus lasting up to 6 months after surgery have been reported after ICJ removal for megacolon management ( 27 , 28 ). In the case reported here, since the mass was located very close to the ICJ, damage to the ICJ was inevitable in removing the mass completely. Based on the ultrasonographic and CT findings, the mass was assumed to be benign, and debulking surgery was performed rather than complete excision of the mass, preserving the ICJ. The prognosis of enteric duplication cysts associated with the small intestine is good if there is no recurrence or malignant transformation of the cyst ( 16 , 17 ). Previously, Bernardé et al. reported multiple enteric duplications originating in the caudal esophagus and duodenum. Recurrence of the esophageal cyst with herniation of the spleen and left lateral lobe of the liver into the thoracic cavity was identified 1 year after repetitive surgical excision at the time of initial surgery. The spleen and the hepatic lobe were restored into the abdomen and the cyst was extensively removed. However, despite additional revision surgery, the cat did not recover from the anesthesia and died postoperatively ( 16 ). Hobbs et al. also reported the recurrence of a duodenal duplication cyst that was diagnosed as a duplication cyst with malignant transformation at initial surgery ( 17 ).
|
Clinical case
|
biomedical
|
en
| 0.999999
|
PMC10870593
|
Dysferlinopathy is a phenotypically heterogeneous group of hereditary myopathies caused by mutations in the DYSF gene that has been mapped to locus 2p13.3-13.1 . Deficiency of dysferlin (a transmembrane protein) leads to impaired repair of the sarcolemma and impaired rhabdomyogenesis [ 2 – 4 ]. In dysferlinopathy, symptoms of skeletal muscle damage have been described in relation to their main phenotypes . While there has been little attention paid to the features and prevalence of articular contractures, it is believed that joint contractures in dysferlinopathy are uncommon and occur in 11.9% to 36% of cases . However, the development of contractures of the ankle joints with the involvement of the Achilles tendon, hip, knee and elbow joints, fingers, and spine is possible [ 5 , 7 – 9 ]. Articular contractures may develop as diffuse muscle damage progresses and occur following outpatient status . Early contractures are considered rare , and rigid spine syndrome (RSS) in dysferlinopathy has been previously reported only once . RSS was first proposed by Dubowitz to describe a subgroup of patients suffering from congenital myopathy with characteristic signs, i.e., early contracture of the spine and respiratory failure. Subsequently, this form was described as a congenital muscular dystrophy with early spinal rigidity (RSMD1) caused by a mutation in the SEPN1 gene and a nosology similar to neurosis—multisystemic selenoprotein deficiency ( SECISBP2 ) . Spinal rigidity is a nonspecific sign in other myopathies caused by mutations in the following genes: LMNA , COL6 , АСТА1 , FHL1 , MYH7 , RYR1 , LAMA2 , CAPN3 , TOR1AIP1 , TK2 , GAA , and TPM3 . The patient exhibited a normosthenic body type, with a body mass index of 22.15. He began walking at the age of 1.2 years, developed normally according to his age, and was engaged in weightlifting until the age of 18. From the age of 13, he noted progressively increasing symmetrical contractures of the flexors of the fingers and elbow flexors of the wrists, as well as increasing weakness in the calf muscles. At the age of 14, a sharp atrophy of the calf muscles developed, which led to contractures of the Achilles tendons and limitations when walking on his heels. During this period, the patient noted general weakness, sweating, and shortness of breath during daily physical activity. From the age of 18, he noted a slowdown in running speed, and by the age of 20, he experienced fatigue of the thigh muscles when climbing stairs and standing from a sitting position. At the age of 22, the patient received glucocorticosteroids (prednisolone, 60 mg tablets q.d.) for one month, which led to a slight reduction in thigh muscle strength that was recovered after the medication was stopped. At the time of his examination, the patient was unable to rise on his toes, and contractures of the long extensors of the toes had formed, the most pronounced occurring on the right extensor halluces longus. At the age of 23, weakness appeared in the muscles of the shoulder girdle and the flexors of the fingers. A neurological examination revealed myogenic, predominantly distal tetraparesis. A moderate decrease in muscle strength (a 4/5 on the Medical Research Council (MRC) scale for muscle strength) was found in the deltoid muscles, deep finger flexors, thigh flexors and adductors, leg extensors, and ankle flexors. A more pronounced paresis was observed in the extensors of the feet (3/5 MRC). Carpal dynamometry was 21/15 kgf. The most pronounced amyotrophies were observed in the posterior muscle group of the legs, with moderate amyotrophies in the posterior muscle group of the thighs. Elbow flexion, as well as Achilles and plantar reflexes, were absent. The most pronounced contractures were noted in the flexors of the fingers (up to 45° of the flexion position in the metacarpophalangeal joints with extended wrist joints), moderate contractures of the ulnar flexors of the wrists (up to 20°), and extensors of the fingers (up to 75° of the flexion position). Recurvation up to 5–7° was noted in the elbow joints. In the distal area of the lower extremities, pronounced contractures were detected in the ankle joints due to retraction of the Achilles tendons (flexion 110°, extension 100/98°) and the toe extensors, which formed a ‘hammer-like’ deformity of the digits. Moderate extensor contractures were noted in the hip joints (up to 100° flexion) due to the retraction of the semimembranosus muscle. Pronounced flexion contractures were also detected in the knee joints up to 110/120°. Rigidity of the spine was noted in the thoracic and lumbar regions and was accompanied by a limitation of trunk flexion to 60–70° . At the initial examination, the patient was 22 years old and presented with elevated levels of serum creatine kinase (CK) (44,060 U/l; normal value = 174 U/l), alanine aminotransferase (ALT) (209.3 U/l; normal range = 0.0–55.0 U/l), and aspartate aminotransferase (AST) (161.9 U/l; normal range = 5.0–34.0 U/l) during active weightlifting training. Following the cessation of training, the level of CK decreased to 19,000 U/l, ALT to 376.4 U/l, AST to 204.5 U/l, and lactic dehydrogenase (LDH) was 761.6 U/l (normal range = 120.0–246.0 U/l). While taking glucocorticosteroids at 22 years of age, the level of CK increased to 29,102 U/l. At the time of the current examination (when the patient was 23 years old), the CK level was 33,463 U/l, CK-MB (myocardial band) was 816.5 U/l, ALT was 510.5 U/l, AST was 431.2 U/l, LDH was 1199.2 U/l, and myoglobin was 4392.0 ng/ml (normal range = 0.0–0.8 ng/ml). All autoimmune markers (e.g., ANA (antinuclear antibodies)/ENA (extractable nuclear antigen), rheumatoid factor, total immunoglobulins, immunoblot of myositis-associated antibodies, and HLA-B27) were negative. A whole-body MRI showed symmetrical and diffuse increases in the MR signal on T2-weighted images (T2-WI) and STIR in all muscle groups of the pelvic girdle and thighs due to moderate edematous changes in the muscles of the anterior, posterior, and medial muscle groups of the thighs. In addition, there were areas of linear and diffuse connective tissue (hypointense on STIR and T1-WI) and, to a lesser degree, fat replacement (hyperintense on T1, T2-WI, and hypointense on STIR). More pronounced areas of connective tissue and fatty degeneration were found in the posterior thigh muscle group (semimembranosus, semitendinosus, biceps femoris cup. longus; the 2b–3 stage by Mercuri). Less pronounced areas of fatty degeneration were noted in the anterior muscle group (vastus lateralis, vastus medialis, vastus intermedius; the 2a stage). The gracilis, sartorius, rectus femoris, and biceps femoris cup. brevis were characterized by moderate edematous changes, while the gracilis and sartorius muscles were also hypertrophied (8.0 cm 2 and 5.4 cm 2 , respectively). Among the muscles of the legs, pronounced fibrous replacement was noted in the soleus and gastrocnemius muscles (2b–3 stage). In contrast, less pronounced changes were found in the tibialis posterior and the muscles of the anterior group (tibialis anterior, extensor digitorum, and peroneus longus; the 2a stage). Moderate edematous changes were observed in the tibialis posterior and anterior muscles on both the right and left sides. In the muscles of the shoulder girdle (supraspinatus, infraspinatus, and subscapularis) and in the muscles of the shoulder, moderate edematous changes were also detected. Moreover, the supraspinatus, infraspinatus, subscapularis, and teres major exhibited areas of fatty degeneration on both sides (stages 1–2a) . A biopsy specimen was obtained from a moderately affected right vastus lateralis muscle from an area of pronounced edematous changes according to the MRI scan (STIR). Frozen sections of the specimen were stained with hematoxylin and eosin, trichrome (according to Gomori), Sudan III, nicotinamide adenine dinucleotide (NADH), vytochrome c oxidase (COX), and superoxide dismutase (SDH), as well as immunohistochemically with antibodies to dysferlin , CD45, CD68, HLA-ABC, and HLA-DR (Abcam, UK). A biopsy specimen of the vastus lateralis muscle from a healthy 26-year-old male was obtained as a control. One biopsy section was processed for transmission electron microscopy using the standard method . The right vastus lateralis muscle biopsy revealed a myopathic pattern of changes as groups of rounded atrophic fibers, necrotic fibers, fibers with a central arrangement of nuclei, and pronounced endomysial and perimysial fibrosis. Furthermore, large droplet intermuscular lipoidosis was determined using Sudan III. Gomori’s trichrome uncovered single torn red fibers and atrophic fibers with increased numbers of mitochondria. Single COX-negative fibers were also detected via COX + SDH staining. Staining for NADH revealed an irregular internal architecture of muscle fibers. An immunohistochemical analysis of the composition of the lymphocytic-macrophage infiltrate confirmed the presence of a pronounced endomysial cell infiltrate, indicating severe inflammation predominantly represented by lymphocytes. A partial violation of the integrity of the sarcolemma was also found, which consisted of an expansion of the subsarcolemmal spaces with flocculent detritus. The basement membrane of the muscle fiber was unevenly expanded and had formed thickenings, disturbing the homogeneity of the membrane. The mitochondria of the muscle fibers were also subject to changes, where subsarcolemmal and interfibrillar accumulations of polymorphic, small mitochondria with an electron-dense matrix were observed . Fig. 3 Pathological examination of the right vastus lateralis muscle biopsy specimen. Hematoxylin and eosin staining ( a ); NADH ( b ); trichrome Gomori ( c ); anti-CD45 ( d ); anti-CD68 ( e ); anti-HLA-ABC ( f ); anti-HLA-DR ( g ); anti-dysf ( h ); control (healthy donor) anti-dysf ( i ); ultrastructural signs of large droplet dystrophy with lipid inclusions ( j ); focal destruction of the sarcolemma ( k ); mitochondria are small and electron-dense ( l ); western blotting shows a complete absence of the dysferlin protein ( n ) when compared to the control ( m ) The patient’s DNA sample was analyzed using whole genome sequencing (WGS) (next-generation sequencing). The mean read coverage for whole exome sequencing in all samples was 78.7×, with a read length of 2 × 75 bp. WGS had an average read coverage of 44.9×, with a read length of 2 × 151 bp. To estimate population frequencies of the identified variants, samples from the 1000 Genomes project, ESP6500, and the Genome Aggregation Database were used. The PolyPhen, SIFT (Sorting Intolerant From Tolerant), and MutationTaster programs were used to predict the possible effect of amino acid substitutions and protein functions. The number of copies of the 40 exons of the DYSF gene was examined using the multiplex ligation-dependent probe amplification (MLPA) method (The SALSA MLPA Probemix P268-A3 DYSF assay; MRC Holland, The Netherlands). Annotation of the exons was carried out according to the assembly LRG_845 ( https://www.lrg-sequence.org ). Potentially pathogenic mutations were identified via comparisons with the normal human genome, and detected changes were confirmed by Sanger sequencing. A previously described, pathogenic mutation in the heterozygous state in the 39th exon of the DYSF gene was detected, leading to the appearance of a premature translation termination site in codon 1428 . The frequency of the detected mutation in the control sample of gnomAD was 0.0014%. WGS also revealed a previously described heterozygous mutation in the DYSF gene, which led to a change in the nucleotide sequence in intron 51 . The mutation was not registered in the control samples: 1000 genomes, ESP6500, ExAC, or gnomAD. According to the SpliceAI prediction algorithm, a mutation could result in an alternative splice acceptor site (SpliceAI_DS_AG: 0.51) or an alternative splice donor site (SpliceAI_DS_DG: 0.67). Therefore, based on the totality of the evidence, the mutation should be regarded as a variant of uncertain clinical significance. The patient had two copies of all exons of the DYSF gene by MLPA, which indicated the absence of large deletions. The patient’s mother was found to be a carrier of the c.4282 C > T mutation, and the father had another mutation in the heterozygous state. Our 23-year-old patient with MM and associated with multiple contractures and spine rigidity without respiratory insufficiency was clinically similar to a previously described case by Nagashima et al. of the proximal-distal phenotype, which reinforces the possibility of a new variant of dysferlinopathy. However, a number of differences exist between our patient and the one reported by Nagashima et al. For instance, in our case, the manifestation of distal contractures was accompanied by the simultaneous development of muscular-dystrophic syndrome in the calf muscles from the age of 13. It is possible that weightlifting accelerated the progression and severity of contractures and muscle weakness . Whereas Nagashima et al. presented a case with a late onset of muscular dystrophic syndrome (a 40-year-old patient), with a primary manifestation of rigidity in the thoracic spine and an increasing development of multiple articular contractures. In our case, rigidity in the cervical region was not detected, possibly due to the relatively early stage of the disease. Furthermore, the CK level was significantly higher (253 times the upper normal limit) than in the Nagashima et al. case (25 times the upper normal limit). The use of glucocorticosteroids at the age of 22 led to slightly reduced muscle strength (which was reversible) and increased CK levels, as previously described in dysferlinopathy patients with a false diagnosis of polymyositis [ 33 – 35 ]. The patterns of fatty distribution and connective tissue infiltration of the muscles (observed via MRI and computed tomography) also differed from the case presented by Nagashima et al. In our patient, pronounced fibrotic changes were noted in both atrophied heads of the gastrocnemius and soleus muscles. In the Nagashima et al. case, minimal fat replacement and relative hypertrophy of the lateral portion of the gastrocnemius muscle were noted. Fatty and connective tissue infiltration of the thighs in both cases corresponded to a posterior-dominant distribution , with the key aspect being the symmetrical, fibrosing nature of the change in the semitendinosus, which limits hip flexion. In our patient, there were no signs of fatty replacement of the paravertebral muscles, which is in contrast to the Nagashima et al. patient, who exhibited pronounced fatty replacement at the lumbar and thoracic levels . Thus, spine rigidity in both cases indicates a fibrosing process that is likely independent of the degree of fatty replacement of the paravertebral muscles. Fanin et al. have suggested that RSS, along with predominant lesions of the axial muscles, be included in the spectrum of dysferlinopathy symptoms. However, in none of the cases of axial muscle damage has pronounced tendon contractures and spine rigidity without respiratory failure been recorded , even with total fatty replacement of the paravertebral muscles . Pulmonary function was normal in our patient, in contrast to the Nagashima et al. patient, who exhibited an elevation in the right dome of the diaphragm . The variability in muscle fiber size, a small number of necrotic and torn red muscle fibers, and the presence of single COX-negative fibers are comparable to the reports by Nagashima et al. and other researchers [ 41 – 43 ]. However, more pronounced endomysial and perimysial fibrosis were observed in our case. Furthermore, in contrast to macrophages being predominant in the composition of cellular infiltrates in dysferlinopathy [ 44 – 46 ], we uncovered pronounced lymphocytic and, to a lesser extent, macrophage (CD68+) infiltrates. Moreover, the endomysial and perimysial nature of the infiltrates did not differ from those previously described [ 33 , 47 – 49 ]. Expression of major histocompatibility complex 1 (MHC1) on the surface of invaded and atrophied muscle fibers can be observed in 71.4% of cases of dysferlinopathy .
|
Review
|
biomedical
|
en
| 0.999994
|
PMC10924677
|
The first successful laminectomy was documented in 1838, although the first laminectomy was performed in 1814 . Since then, decompressive laminectomies have become commonly performed surgeries. The main goal of a laminectomy is to decompress the spinal canal to relieve spinal canal stenosis. Spinal canal stenosis can be secondary to degenerative stenosis, fractures, spinal tumors, spinal vascular lesions, epidural abscesses, and congenital deformity . Indications for laminectomy may include patients refractory to non-surgical management, such as medication, physical therapy, and epidural injections; presence of intractable pain or progressive neurological deficits; and cauda equina syndrome . Laminectomy can be achieved with open or minimally invasive approaches. Various technological advances, including high-speed drills and ultrasonic osteotomes, have allowed the surgeon to make precise osteotomies while protecting adjacent soft tissue structures . Haddas, et al. demonstrated a technique using an ultrasonic osteotome in a retrospective study of 85 patients who underwent the H laminectomy. In this technique, two longitudinal troughs were made from the top to the bottom of the laminae of interest, followed by a transverse trough through the superior third of the lamina, connecting the longitudinal troughs, forming the letter H. Then, the superior third of the lamina was removed using rongeurs. They did not cause any dural tears or cerebrospinal fluid (CSF) leaks. The constant visualization and tactile feedback of the tip of the instrument and osteotome provided an inherent safety mechanism and allowed enhanced control of the dura-ligamentum interface, even for non-experienced surgeons. They concluded that the H laminectomy is a safe and effective way to perform a lumbar laminectomy . Our technique is similar to the Smith-Peterson osteotomy, an approach for flexion deformity correction where bilateral facet joints, partial lamina, and posterior ligaments are resected at the osteotomy site to bring the posterior column closer and open the anterior column . Here, we first describe our experience in cadavers where laminectomies from lumbar one to five were performed. A posterior midline lumbar incision was made down to subcutaneous fat followed by a subperiosteal dissection. Then, the superior and inferior interspinous ligaments at the level of interest were divided with a Bovie. A spine navigation system was utilized, placing the frame on the spinous process at the level below. We left the spinous process on the lamina of interest in place so that Kocher forceps could be used to grasp and remove the lamina. The lamina and the pars interarticularis were identified. Using a handheld osteotome and mallet, two vertical cuts were planned with the spinal navigation system and made on the lamina, one on each side at the level of interest. Next, two oblique cuts were made at the pars interarticularis, one on each side at the level of interest . At this point, the lamina was freed from bony attachments. Next, a Kocher was used to grasp the spinous process and gently elevate the lamina, which was attached to the underlying ligamentum flavum, epidural fat, and dura. A Woodson elevator and upgoing curette were used to detach these structures from the lamina. The lamina was then freely removed with the Kocher. The ligamentum flavum, epidural fat, and dura were visualized and appeared to remain intact. A deficiency in cadaver was a lack of CSF distended dura and spinal stenosis. This procedure was then repeated at an additional level, first making a partial cut with the osteotome, followed by confirmation with the spinal navigation system to ensure correct placement. Finally, osteotomes were used to complete the cuts, exposing and removing the lamina and then the ligaments. These were inspected visually. The process was then repeated on an additional cadaver from lumbar one to lumbar five without spinal navigation. The technique without the use of spinal navigation was taught to other residents and attending physicians, and the procedure was repeated on two more cadavers in the lumbar regions, with visual inspections completed. There were no violations of the dura or nerve structures. Our experience with cadavers demonstrates that this technique is safe and effective in performing laminectomy. A 27-year-old male presented with a complaint of back pain and inability to move his legs after landing on his buttocks from falling off a ladder approximately 8 feet from the ground. Prior to the injury, he was neurologically intact. After the fall, his motor strength was 5/5 in bilateral upper extremities, 1/5 in right hip flexion, and 0/5 in all other muscle groups in the lower extremities; sensory was intact at T12 level; and reflexes were positive for bulbocavernosus reflex, positive rectal tone, negative anal wink, and negative patellar and Achilles reflexes. Thoracic spine computed tomography (CT) demonstrated a T12 chance fracture with 50% loss of height, 25 degrees of angulation with associated T11 spinous process fracture, and 10 mm retropulsion with 60% canal encroachment. He was given an ASIA C Spinal Cord Injury score. The patient underwent open reduction and internal fixation (ORIF) of T12, T11-T12 laminectomy, and posterior lumbar arthrodesis from T10 to L2. Somatosensory evoked potentials (SSEPs), motor evoked potentials (MEPs), and electromyography (EMGs) were placed, then the patient was placed prone on the operating table. The patient was prepared and draped in the standard sterile fashion. Prophylactic antibiotics were given prior to incision. Monopolar cautery was used to dissect away the subcutaneous fat in the avascular plane. Subperiosteal dissection from the spinous process to the lamina to the transverse process was made using bipolar cautery from T10 to L2. A spinous process clamp was placed at L2. O-arm assisted navigation was used to localize the T12 fracture and the T10 to L2 vertebral segments were identified. Navigation was used for T10 to T12 pedicle screw placement. Next, T11-T12 laminectomies were performed. The interspinous ligaments of T10-T11 and T12-L1 were cut via rongeur. Next, after confirmation with the spinal navigation system, two vertical cuts were made on the lamina and two oblique cuts were made at the pars interarticularis at T11 and T12 to break through dorsal cortex and ventral cortex bilaterally . A nerve hook was used to elevate the ligamentum flavum, which was resected bilaterally at the cranial and caudal margins via Kerrison rongeurs. A Kocher was placed at the T11 spinous process and the lamina was slowly elevated, freed from underlying dura with a Woodson elevator. There was no cerebrospinal fluid leakage. Two rods were placed and secured with cap screws. The wound was copiously irrigated with antibiotic irrigation. Decortication was carried out at the lamina, spinous process, and facet joints. A subfascial drain was placed. The incision was closed in the standard fashion. Postoperatively, the patient reported improved back pain. The motor exam improved to 4/5 in bilateral hip flexion, knee extension, and knee flexion, and 1/5 in dorsiflexion, plantar flexion, and hallucis extension. Sensory level remained intact around the T12 level. The patient was able to perceive proprioception and pressure touch in bilateral lower extremities. He was discharged to acute rehabilitation. Decompressive laminectomies are common in spine surgery, benefiting from advancements like rongeurs, high-speed drills, and ultrasonic osteotomes, which provide precision and protect soft tissues . Our technique involves two vertical cuts on the lamina and two oblique cuts at the pars interarticularis, differing from the H laminectomy method . The cut across the lamina in the ultrasonic H laminectomy technique to free the lamina from its bony attachments can be dangerous because the spinal cord is directly underneath without the ligamentum flavum as a buffer. In our procedure, because we make the cuts at the pars interarticularis, which is safer, there is no need to cut across the lamina and run the risk of injury to the spinal cord. The ligament in this procedure is cut with scissors while the lamina is lifted off. The use of ultrasonic osteotomes has shown advantages over burrs, reducing operative time, blood loss, and study duration . In a study by Hu et al., en bloc laminectomy using an ultrasonic osteotome shortened operative time from 94.8 to 65.9 minutes for the latter 75 of 151 patients . While handheld osteotomes might raise concerns about feedback, our study suggests their safety in laminectomy procedures. To mitigate risks during the laminectomy using a handheld osteotome, we meticulously identified key anatomical landmarks: spinous process, lamina, transverse process, facet joints, pars interarticularis, and interlaminar space. Proper placement of the osteotome at the lamina is crucial to avoid damage to the ligamentum flavum, spinal cord, or nerve roots during hammering. Positioning errors, such as medial or lateral misplacement, can lead to spinal cord or facet joint injuries. Careful targeting of the ventral cortex is essential; if too posterior, the lamina won't detach, and if too anterior, there's a risk of injuring exiting nerve roots. Perpendicular osteotome placement at the lamina-facet junction is necessary to prevent skiving or incomplete cutting. Elevating the lamina requires caution to avoid tearing the attached ligamentum flavum or dura, which could lead to cerebrospinal fluid leakage. Despite performing a pure laminectomy without O-arm navigation, our case study, which incorporated O-arm guidance for pedicle screw placement, helped verify anatomical landmarks and minimize risks. No spinal cord, nerve root, or CSF complications were encountered, and postoperative improvements were observed in motor, sensory, and reflex functions, with no changes in SSEPs, MEPs, and EMGs. The use of a handheld osteotome to perform laminectomy provides several advantages. First, this technique is effective in removing the lamina, as demonstrated in the cadavers and our case study. Second, the technique appears to be safe, given the ligamentum flavum, epidural fat, and dura remain intact after the removal of the lamina. Third, this technique is thought to be fast relative to using a high-speed drill or ultrasonic osteotome, which the latter techniques can take a considerable amount of time in multi-level laminectomies. With a few simple motions with the mallet, the lamina can be freed of bony attachments. Prior to each hit with the hammer, we use either tactile feedback or navigation, if available, to ensure that the osteotome is on the lamina and not in an unsafe location. Fourth, a handheld osteotome is low-cost and widely available when compared to a high-speed drill or ultrasonic osteotome. Given that some facilities may not have advanced tools, the ability to use a handheld osteotome as a tool to perform laminectomy can be useful and powerful. There are some limitations to our study as well. We document the experience with this novel method using multiple cadavers and a single intraoperative case study. Future studies should investigate if this technique is safe and effective in a large case series with various surgeons. The use of a handheld osteotome offers the potential to further reduce operative time, especially in multi-level laminectomies. Future studies should record the actual duration of laminectomies using different techniques. Also, our experience in the case study involved only one surgeon, and this calls for other surgeons to consider and perform this technique. Finally, technical advances from microscopes to, more recently, exoscopes have allowed for better intraoperative visualization of the surgical field through magnification and higher resolution. In a recent systematic review and meta-analysis comparing microscopes and exoscopes, the exoscope appears to be superior in video quality and offers better ergonomic features . Future studies should investigate the role of the exoscope in handheld osteotome laminectomy. The decompressive laminectomy is a commonly performed surgery. Although there have been many technical advances, some facilities may not have access to the costlier surgical tools or the familiarity with them. Here, we describe the use of a handheld osteotome, which is widely available and at low cost, in performing a laminectomy. Our experiences with cadavers and a case study show that this technique appears to be safe and effective. The technique also has the potential to reduce the actual duration of laminectomy, especially in multi-level laminectomies. Future studies should investigate the feasibility of this technique along with the role of the exoscope.
|
Review
|
biomedical
|
en
| 0.999998
|
PMC11068315
|
Intussusception is defined as the telescoping of one segment of bowel into an adjacent segment of bowel. This pathology presents with symptoms such as intermittent abdominal pain that fluctuates in severity, vomiting, bloating, and sometimes bloody bowel movements. It increases the risk of intestinal obstruction which can ultimately lead to ischemia, necrosis, perforation, and sepsis. 1 Intussusception commonly occurs within the small bowel and targets the male pediatric population, typically within the age range of 6 to 18 months although cases can occur up to six years. Risk factors in children include viral and bacterial infections, older versions of the rotavirus vaccination, intestinal polyps, or cystic fibrosis due to altered intestinal motility. 1 Despite this, a majority of cases of pediatric intussusception (PI) are of unknown etiology. On the other hand, intussusception is a rare occurrence in the adult population and reflects only 5% of all cases across all ages. In contrast to pediatric cases, adult cases present with pathologic lead points on imaging and as much as 90% of cases are secondary to neoplasms, which act as anatomical obstructions. 2 A 50-year-old female patient presented to the ED for evaluation of five days of abdominal pain. She initially attributed the pain to constipation; however, the pain progressed to the point where it was limiting her activities of daily living and ability to sleep. She reported having a bowel movement of normal color and consistency on the morning of her ED visit. Recently, she had an esophagogastroduodenoscopy (EGD) and colonoscopy performed and was diagnosed with Helicobacter Pylori gastritis, for which she was adequately treated. She denied fevers, chills, sick contacts, nausea, vomiting, diarrhea, red or dark stools, chest pain, or shortness of breath. Her physical exam was notable for minimal epigastric tenderness upon deep palpation, but her abdomen was otherwise soft and non-distended with no guarding or rebound tenderness. Differential diagnoses included but were not limited to small bowel obstruction, acute coronary syndrome, pancreatitis, cholecystitis or biliary colic, or gastritis. The patient was treated with a bolus of intravenous fluids at one liter over 60 minutes; at that time her pain was not severe enough to require analgesics. She was told to restrict oral intake while anticipating the CT results. The patient’s vitals remained within normal limits throughout the course of her stay. Lab tests were notable for 40.3% lymphocytes seen on complete blood count, moderate leukocyte esterase with 5–10 WBCs/hpf, and few bacteria seen on urinalysis. Computed tomography imaging of the abdomen and pelvis with intravenous and oral contrasts was obtained. In the axial view, one will see a concentric ring formed by layers of bowel, mesenteric vessels, and fat (red arrow and circle); this is the equivalent of the ultrasonographic “target sign.” The inner ring (blue arrow) represents the lead point causing telescoping of the bowel. One can see that the proximal bowel is dilated (yellow arrow). In the coronal view, one can see an obstructive mass, also known as the lead point (red arrow), located in the lumen of the descending colon. Located proximal to the lead point are dilated loops of bowel with edematous changes and fat stranding (pink circle). The proximal portion of the bowel will take on a concentric appearance with the telescoping loop of bowel. Four days later, a general surgeon performed a laparoscopic left colectomy with laparoscopic splenic flexure mobilization and hand-sewn colo-colonic anastomosis. Per the operative note, the surgeon found a 3.8 cm submucosal lipoma with a focal ulcer and ischemic changes in the overlying mucosa. There was also mild serositis with serosal fibrosis and adhesions, but the pathology of the obtained tissue was negative for dysplasia or malignancy. The postoperative course was unremarkable, and the patient was subsequently discharged to home without complications. Intussusception requires two key components: peristaltic contraction and a lead point. 3 Etiologies of pediatric intussusception are often benign and most commonly idiopathic. In children, the classic symptom triad is intermittent abdominal pain, bloody or “currant jelly” diarrhea, and a palpable tender mass on physical exam. 3 , 4 This triad is not seen in the majority of pediatric cases, and is most certainly not seen in adult cases. A majority of the cases occur between the ileum and the cecum and management involves barium or air enemas. Surgical resection is less common in the pediatric population. 3 Diagnosis can be achieved with ultrasound, CT scan, or barium enema, although in the adult population, the first two options are the most popular and more sensitive tests. If a patient presents with a palpable abdominal mass, utilizing POCUS (point-of-care ultrasound) can have more than 90% sensitivity in diagnosing AI, although this may be affected by body habitus or the skill level of the ultrasonographer. 2 Ordering a CT for diagnosis can have between 58–100% sensitivity and 57–71% specificity. 5 On CT, you will expect to find all three layers of the bowel, possibly in addition to mesenteric vessels and fat, telescoping into an adjacent segment of bowel with surrounding edema. 6 A lead point such as a malignant lesion, polyp, stricture, or diverticulum will likely be visible near the affected bowel. The segment may appear as a sausage-shaped mass when looking along its longitudinal axis; however, a cross-sectional view of the bowel segment may reveal a target-like or bull’s eye-lesion. This cross-sectional finding would be expected on an abdominal ultrasound exam as well. 3 Between 75–90% of cases of AI have been diagnosed with an evident lead point, a majority of which are caused by malignant neoplasms. 7 Based on a meta-analysis of 40 retrospective case series, colonic intussusception only comprised 19.9% of adult cases and among those cases, 46.5% had diagnostic testing that revealed a malignant tumor as the lead point. 7 In contrast with the pediatric population, management of AI largely involves surgical exploration and resection, especially if malignancy is highly suspected as the etiology. 6
|
Review
|
biomedical
|
en
| 0.999998
|
PMC11122089
|
Fibrillins are large cysteine-rich glycoproteins that are major constituents of the extracellular matrix (ECM) that merge into microfibrils . The fibrillin microfibrils are extensible polymers that provide connective tissue elasticity and are extensively spread in tissues and organs. They serve as templates for elastin deposition during elastic fiber formation and are essential for maintaining the integrity of tissues such as blood vessels, lungs, skin, and ocular ligaments . The presence of a small proline-rich domain in fibrillin-1 that is replaced by a glycine-rich domain in fibrillin-2 is the main difference between fibrillin-1 and fibrillin-2 . Nevertheless, the significance of these domains in matrix assembly is obscure and each fibrillin protein is encoded by a specific gene . The proteins encoded by the two fibrillin genes, FBN1 and FBN2 , respectively, share 71.2% similarity but may play distinct significant roles in the formation of the ECM that may underlie varying phenotypic expressions ( Table 1 ) . The gene encoding fibrillin-1 encompasses 65 exons covering 200 kb of genomic DNA which is located on chromosome 15q21.1. Fibrillin-1 contains 47 motifs similar to the human epidermal growth factor (EGF) . A total of 43 of these 47 EGF-like motifs present a consensus sequence for calcium binding (cbEGF) . Each motif is composed of six cysteine residues that form disulfide bonds between C1 and C3, C2 and C4, and C5 and C6 which provides stability for its three-dimensional structure . The calcium binding to cbEGF domains offers fibrillin-1 enhanced stability, protection against proteolysis, and structural elements for communication with numerous constituents of the ECM . Wide stretches of these calcium-binding EGF-like motifs are disrupted by some important domains comprising seven of these motifs, with similarity to the latent transforming growth factor β1 binding protein (LTBP) . The FBN2 gene located on chromosome 5q23-3, spanning more than 28 kb and 65 exons, was identified while cloning the FBN1 locus situated in 15q15-21.3 , and encodes fibrillin-2, a 2912 amino acid-containing protein with five different structural domains and length similar to fibrillin-1 . The main structural region comprises 41 calcium binding-epidermal growth factor (cbEGF)-like domains . Fibrillin-2 is expressed earlier in development and is constrained to bone and cartilage matrices in adult tissues and is essential in elastic fiber formation . The gene FBN2 has high similarity to FBN1 ; as a result, pathogenic variants in FBN2 have been reported to cause a phenotypically related disorder termed congenital contractual arachnodactyly (CCA) ( Table 1 ), which also presents with Marfanoid body habitus and arachnodactyly . Due to the phenotypic similarities of CCA and MFS, establishing the incidence and prevalence has proved futile . Herein we delineate the phenotypic features and genetic variants of two cases of fibrillinopathy associated with novel variants in FBN1 and FBN2 . Proband A was born at an outside hospital to a 31-year-old G4P3014 Hispanic mother, weighing 3780 g after a gestation period of 39 weeks. The patient’s prenatal history is significant for premature atrial contractions (PACs) as well as left-sided ureterohydronephrosis. The infant was born via a scheduled repeat low transverse caesarean section and Apgar scores were 3 and 7 at 1 and 5 min of life, respectively. Initially, he was hypotonic with no cry and a heart rate of approximately 100 bpm. Despite initial resuscitation with continuous positive airway pressure (CPAP) up to 100% oxygen supplement, the infant continued to have weak tone, flexed posture, and desaturations with a weak muffled cry. He also had a loud 4/6 holosystolic and a diastolic murmur with a palpable thrill. The remainder of his physical examination was notable for dusky color, skin rash, macrocephaly, folded and creased ears, clenched jaw, long thin fingers, clenched hands, flexed body posture, lack of creases on palms and soles, long thin feet and toes, and abnormal shape of the rib cage . The infant was admitted to the neonatal intensive care unit (NICU) for cardiorespiratory support. His chest X-ray demonstrated severe cardiomegaly and his arterial blood gas analysis (ABG) was significant for severe acidosis with a pH of 7.05 and PaCO 2 of 106 mmHg. Initial postnatal echocardiogram was notable for moderate right ventricular hypertension with elevated peak tricuspid regurgitation pressure gradient (TRPG) of 49 mmHg and moderate to severe aortic sinus dilatation (Z = +6.5) as well bidirectional atrial shunting through a patent foramen ovale (PFO), small left-to-right shunting through a patent ductus arteriosus (PDA), mild to moderate mitral regurgitation (MR), moderate tricuspid regurgitation, mild aortic regurgitation, and moderate to severe pulmonary sinus dilatation. Despite further treatment with vasopressors, hydrocortisone, surfactant, and broad-spectrum antibiotics, he continued to have persistent severe pulmonary hypertension (PPHN) and hypoxemic hypercapnic respiratory failure with a mean Oxygen Index (OI) of 60 and therefore was transferred to our NICU on day of life (DOL) 3 for further evaluation and management. Despite escalating his respiratory support to mechanical ventilation and starting inhaled nitric oxide to reduce pulmonary pressure, he remained hypoxemic with mean oxygen saturation levels around 85%. A repeat echocardiogram on DOL 3 revealed severe tricuspid regurgitation with prolapse, moderate to severe aortic sinus dilatation (Z = +8.1), severe pulmonary sinus dilatation, as well as new mildly diminished left ventricular systolic shortening . On the abdomen, renal, and bladder ultrasound, he was found to have grade 3 left hydronephrosis without hydroureter according to the Society of Fetal Urology (SFU) classification . His PPHN was refractory to prostacyclins (Treprostinil, Epoprostenol), and Sildenafil. Despite maximal medical therapy, he continued to have desaturations and hypotension. Per his parents’ request, his care was redirected toward the patient’s comfort care. On DOL 10, he expired after compassionate extubation per parental request. A summary of the clinical course of proband A is shown in Figure 4 . Proband B was born to a 34-year-old G4P2 Hispanic mother, weighing 3410 g after a gestation period of 38 weeks and 3 days. The patient was prenatally diagnosed with Dextro-Transposition of the Great Arteries (D-TGA) with a fetal echocardiogram at 20 weeks of gestation. The infant was born via normal spontaneous vaginal delivery. Apgar scores were 9 and 9 at 1 and 5 min of life, respectively. The infant cried spontaneously at birth and remained notably cyanotic at 5 min of life. In the NICU, he initially presented with paradoxical hypoxemia (i.e., higher lower extremity saturations versus upper extremity saturations). Chest X-ray upon admission was significant for moderate cardiomegaly and the initial echocardiogram demonstrated a very small PFO with minimal atrial level shunt. Given persistent hypoxemia in the setting of known D-TGA, the decision was made to pursue a bedside balloon atrial septostomy (BAS) while he was on continuous Prostaglandin E1 (PGE1) infusion to maintain ductal patency with a plan for an atrial switch operation (ASO) in the first week of life. The patient tolerated the septostomy without any complications and a repeat echocardiogram confirmed a large PDA measuring 5.3 mm . The patient remained at goal oxygen saturations and PGE1 was discontinued on DOL 1 with a repeat echocardiogram on DOL 2 now demonstrating a reduced, moderate PDA measuring 3 mm. He remained hemodynamically stable until DOL 4, when he developed hypoxemic hypercapnic respiratory failure and hypotension requiring mechanical ventilation and vasopressor support, respectively. Additionally, sepsis workup and broad-spectrum antibiotics were initiated on DOL 6; he underwent ASO, PDA ligation, and ASD closure without any complications and was admitted to the pediatric cardiac intensive care unit postoperatively on vasopressors. The echocardiogram demonstrated interval postsurgical changes as well as mild to moderate mitral regurgitation, estimated RVSP of 45 mmHg plus right arterial pressure, and right and left peripheral pulmonary artery stenosis with 45 mmHg and 35 mmHg, respectively . During the remainder of his hospital course, he was weaned off all cardiopulmonary support without any issues and followed serially with an echocardiogram until being discharged on DOL 20. Exome variant analysis was performed in accordance with ACMG recommendations. In total, 8 homozygous, including one interval ~6 Mb, variants that were not considered significant or contributary, as well as 212 rare heterozygous protein-altering variants of uncertain clinical significance (VUS’s) were identified across 216 genes. A primary gene list was generated from the Human Gene Mutation Database (HGMD) and Online Mendelian Inheritance in Man (OMIM) using the keywords congenital heart defect, D-TGA, VSD (ventricular septal defect), ASD (atrial septal defect), or PDA (patent ductus arteriosus), and no significant single-nucleotide variants (SNVs) or small deletions and insertions (<10 bp) associated with our patient’s congenital heart defects were detected. However, compound heterozygous c.518C>T and c.8230T>G variants of uncertain clinical significance in the FBN 2 were identified ( Table 3 ). MFS is an inherited autosomal dominant disorder of the connective tissue with major expressions in the skeletal, ocular, and cardiovascular systems and also in the pulmonary system, integument, and dura . Due to the ubiquitous nature of fibrillin microfibrils, MFS often involves multiple organ systems . Hence, FBN1 pathogenic variants are also accountable for diverse albeit overlapping inherited disorders ( Supplemental Table S1 ). Patients with MFS have diverse clinical variability, with nMFS syndrome being the most critical presentation in early childhood . In 2016, 1318 various FBN1 pathogenic variants linked with MFS were identified; however, only 59 (4.8%) comprising 37 missense mutations (2.8%) were linked with nMFS , again indicating that distinct genotype–phenotype associations may potentially dictate the timing and severity of the clinical presentation in the form of neonatal MFS (nMFS) versus MFS . Neonatal Marfan syndrome (nMFS) is the term used to describe patients diagnosed at birth or over the first 3 months of age . Early-onset MFS is caused by de novo variants with no family history and phenotypes expressed in the antenatal, neonatal, or infancy stage preceding that seen in classical MFS . Associated phenotypic features include joint contractures, arachnodactyly, crumpled skin, and ectopia lentis . Congestive heart failure due to mitral and/or tricuspid valve insufficiency is the major cause of death in the first 2 years in nMFS, in contrast to the classic MFS . Chromosomal abnormalities including whole-gene deletion or exon deletions and duplications rarely occurred (3.3%) but have been identified to be on the rise after the adaptation of multiplex ligation-dependent probe technique and array analysis . Like other reported cases, our patient presented with cardinal features of nMFS, including respiratory distress, congenital cardiomegaly, polyvalvular disease, dysmorphic features, and arachnodactyly. In the absence of family history, a clinical diagnosis was made using phenotypic and echocardiographic criteria. The genetic diagnosis was confirmed after infant mortality. Whole-genome SNP microarray was useful in identifying a novel 107 kb interstitial deletion involving chromosome 15 within 15q21.1 spanning exons 7–30 of FBNI . This pathogenic variant of FBN1 , [NM_000138.5], occurred de novo and has not been previously reported. Accordingly, our patient met the criteria for the diagnosis of MFS defined in Ghent nosology with emphasis on the presence of cardiovascular, skeletal, ocular, and skin manifestations in combination with FBN1 mutation or family history . Even though pathogenic variants in exons 24–34 are associated with the presence of ectopia lentis in neonatal MFS , this feature was absent in this patient. Together, the clinical features in combination with the cytogenomic testing provided a strong diagnosis of nMFS. Infant mortality with acute early-onset MFS is 95% during the first year of life with insufficient data on survival into the third and fourth year . The region of interstitial deletion partially overlaps with exon 24–34, which removes a substantial section of the FBN1 gene, resulting in haploinsufficiency or loss of function of one allele of the gene. Studies have confirmed that a half-normal copy of the FBN-1 protein is not enough to initiate the assembly of microfibrillins . Hence, the assumption is that this region plays an essential role in the function of FBN-1 protein, resulting in the earlier onset and severe expressivity of the disease . The phenotypes and the severity of the disease in our patient could also be attributed to mutation in other regions outside the neonatal region (exon 24–34). About 92% of affected individuals have an affected parent and 25% of probands have novel alteration . Unfortunately, there was no consent for parental testing to evaluate the possible source of the deletion. Although nMFS is the most severe form of fibrillinopathies, it is poorly diagnosed and genetically/phenotypically different from the classical MFS . Previously, several reports indicated that individuals with nMFS have pathogenic variants in FBN1 occurring most likely de novo and mainly specific to exons 24–32, referred to as the ‘hotspot’’ or the neonatal region . Recently, the reason for the pathogenicity of variants in this region has also been attributed to increased proteolytic susceptibility of FBN-1 as well as loss of function for binding of heparin , which may affect the arrangement of the microfibrils for their incorporation into polymeric microfibrils and this is a strong indication that the region plays a vital role in elastic microfibril formation . There are also a few reports whereby nMFS could occur due to pathogenic variants outside this region, twice reported in exon 4 and once in exon 21 . Genetic variants in genes including TGFBR1 , TGFBR2 , TGFB2 , TGFB3 , SMAD2 , and SMAD3 result in Loeys–Dietz syndrome and are reported to cause Marfan-like phenotypes and variants in FBN2 and COL3A1 result in congenital contractural arachnodactyly and Ehlers–Danlos syndrome type IV . Additionally, reports in the literature of patients with MFS phenotype with deletions in chromosome 15q21.1 involving the FBN1 locus had deletions in other genes and all these deletions are different from that reported in our patient with deletion resulting in the nMFS. Variants in the FBN2 are associated with autosomal dominant CCA [MIM:121050]. Pathogenic variants identified in FBN2 assemble in a restricted domain similar to where severe MFS pathogenic variants assemble in FBN1 , mostly between exons 23 and 32 , a region that encodes the cbEGF-like domains, and may occur throughout the gene with a greater number of these pathogenic variants associated with CCA. The pathogenic variant causes a decrease in the amount of FBN-2 protein available to form microfibrils; hence, low levels of microfibril present reduce the elasticity of fibers, resulting in the symptoms exhibited by CCA patients . Currently, only 91 pathogenic variants in the FBN2 gene linked with CCA are reported in the literature, as recorded in the Human Genome Mutation Database (HGMD) . In addition, there are no known genotype–phenotype correlations for FBN2 and congenital cardiac defects such as dextro-transposition of the great arteries (D-TGA) at the time of publication. We report a patient with compound heterozygous mutations in the FBN2 gene. Proband B was prenatally diagnosed with D-TGA based on a fetal echocardiogram at 20 weeks of gestation and required BAS on DOL 0 and subsequent ASO, ASD repair, and PDA ligation on DOL 5. Upon clinical exome sequencing of proband B and his parents, we identified novel compound heterozygous missense, c.518C>T and c.8230T>G , variants in the FBN2 . Even though variants in FBN2 are associated with autosomal dominant CCD , neither of these variants has previously been reported in the literature in individuals with this condition or with CHDs. The variant c.518C>T (p.Thr173Ile), inherited from the mother, has previously been observed in the general population at a low frequency, while the variant c.8230T>G , inherited from the father, has not previously been observed in the general population. The two mutated amino acids are not located in any known critical domain. Pathogenicity predictions using two separate software prediction programs, (SIFT ( http://sift.jcvi.org/ ) and PolyPhen ( http://genetics.bwh.harvard.edu/pph/ )) were not in agreement for both variants. Within the primary gene list and the genes annotated, using HGMD and OMIM, there were no established clinically significant SNVs or small deletions and insertions identified which can elaborate on the primary clinical concerns seen in this patient. The proband’s parents were heterozygous carriers and had no signs of fibrillinopathies associated with the clinical manifestations of the patient, and family history did not reveal consanguinity. The majority of clinically significant mutations in FBN2 result in pathogenic missense or splice site variants which usually assemble in the middle section of the gene encoding several amino acids in EGF-like domains by altering critical binding sites (cysteines) and result in an affected protein product . Table 4 provides a summary of reports in the literature on FBN2 variants that cause CAA and are associated with different heart defects not observed in the patient. In addition, intragenic in-frame deletions in FBN2 have also been reported to cause a strongly expressed mutant mRNA, implying that the encoded shortened protein is integrated into the ECM and distorts the proper folding of the fibrillin-2 protein . In another report, a recurrent intragenic FBN2 deletion within exons 1–8 was observed in healthy individuals. Hence, this implies that haploinsufficiency may not be the main mechanism of action but rather a dominant-negative effect of the FBN2 mutant over the wild-type protein . To our knowledge, this is the first report of a patient with compound heterozygous FBN2 variants who presents with D-TGA not linked with CCA. All human studies were conducted in accordance with the regulations of the University of California Los Angeles (UCLA) Institutional Review Board (IRB). All subjects provided written informed consent to participate in this study. Electronic medical records, family history, and specimen collection were acquired through the UCLA Congenital Heart Defect (CHD) BioCore following the UCLA-IRB-approved protocols. All specimens were de-identified and coded following acquisition. Prenatal diagnosis was determined based on serial fetal sonography and echocardiography findings. Clinical diagnosis was determined based on clinical features and echocardiography findings. SNP Microarray was performed for proband A using genomic DNA (gDNA) isolated from peripheral blood monocytes at the UCLA Clinical Genomics Center following clinically validated CLIA (Clinical Laboratory Improvement Amendments)- and CAP (College of American Pathologists)-validated protocols. Whole-genome Single-Nucleotide Polymorphism (SNP) oligonucleotide array was used to assess copy number variations (CNVs), insertions, deletions, duplications, and genomic imbalances in the sample tested. The assay compared proband A’s DNA to an internal reference and to an external reference from 380 normal controls using the Affymetrix Genome-Wide SNP Array CytoScan™ HD (ThermoFisher Scientific, Waltham, MA, USA) for both normalization and comparative analysis. This array platform contains 2.6 million markers for CNV detection, of which 750,000 are genotype SNPs and 1.9 million are non-polymorphic probes, for whole-genome coverage. The analysis was performed using the Affymetrix Chromosome Analysis Suite (ChAS) software, version 3.1.0.15 . The genomic DNA was extracted from peripheral blood monocytes (PBMCs) at the UCLA Congenital Heart Defects BioCore by using standard methods (Purelink Genomic DNA Mini Kit, Invitrogen, Waltham, MA, USA). Library preparation, sequencing, and data analysis were performed at the CCRD (California Center for Rare Disease) and the UCLA Clinical Genomics Center, using the CLIA-validated protocols. Genomic DNA (3 µg) samples from the proband and parents were subjected to library preparation and exome capture following the Agilent Sure Select Human All Exon 50 Mb (Agilent Technologies, Santa Clara, CA, USA) Illumina Paired-End Sequencing Library Prep Protocol. Sequencing was performed on an Illumina HiSeq4000 (Illumina, San Diego, California, United States) as a 50 bp paired-end run. For each sample, approximately 200 million independent paired reads were generated for an average coverage of 140X of RefSeq protein-coding exons and flanking introns (+/− 2 bp), with at least 95% of these bases covered at ≥10×. The sequences were aligned to the hg19/b37 genome release by using the Novoalign function. PCR duplicates were marked using Picard. The Genome Analysis Toolkit (GATK) was used for indel realignment and base quality recalibration. Both SNVs (single-nucleotide variants) and small INDELs (insertions and deletions) were called using GATK unified genotyper. All variants were annotated using the customized VEP (variant effect predictor) engine from Ensembl. Regions of homozygosity by descent were determined using PLINK. Rare variants with a minor allele frequency of <1% in public databases were retained for further analysis . Candidate rare variants were classified based on their zygosity and pattern of inheritance, their location within the gene, conservation scores, population and allele frequencies (ClinVar), predicted consequence at the protein level and structural domains, pathogenicity prediction in silico tools, evidence from functional studies and animal models, and disease spectrum, in accordance with the ACMG/AMP Guidelines for Interpretation of Sequence Variants . All variants were interpreted in the context of the patient’s phenotype. Variants were dismissed if they were predicted to be tolerant (have low impact on protein structure or function) or have been reported in the GnomAD database. Finally, the technical quality of the candidate variants was confirmed using the Integrative Genomics Viewer (IGV) v2.16.0 . This study reports the first novel interstitial FBN1 deletion in proband A that occurred de novo. The interstitial deletion has a significant impact on the normal functioning of the protein, resulting in a severe form of nMFS. The phenotypic features seen in our patient signify a genotype–phenotype association in patients with nMFS and also elaborate on the information associated with the clinical features of nMFS. Although we did not observe fibrillinopathy in the form of CCA in proband B, complex congenital heart defects (CCHD) have been reported in FBN2 mutations. However, the significance of isolated D-TGA in FBN2 variants in particular remains to be seen, as this conotruncal lesion is typically not associated with any genetic abnormalities or familial inheritance patterns. Therefore, the FBN2 compound heterozygous variants c.518C>T and c.8230T>G, which are currently classified as VUSs, may represent a possible genotype–phenotype correlation together.
|
Study
|
biomedical
|
en
| 0.999998
|
PMC11143068
|
We here report the case of a 1.8-kg baby girl with omphalocele born naturally via vaginal birth to a primipara mother at 37 weeks gestation. Omphalocele is a congenital malformation of the abdominal wall in which the organs of the abdomen stick out through an opening in muscles in the area of the umbilical cord. These organs are covered by a transparent membrane. The patient underwent a 2d ultrasound which revealed biventricular hypertrophy, intact ventricular septum, small patent foramen ovale with left-to-right shunt, and good biventricular systolic function. Trisomy 18 is the most frequent abnormality associated with omphalocele (22% to 89% of fetuses having omphalocele) followed by trisomy 13. Survival rates for babies who have an omphalocele and serious problems with other organs are about 70 percent. Omphalocele occurs when the gut contents fail to rotate and return to the abdominal cavity after normal embryonic herniation into the umbilical cord during weeks 6-10 of development. This study involved patients with a minor omphalocele (a defect measuring ≤4 cm) or a giant omphalocele. In the case of untreatable omphalocele, the intestine which remains outside the abdomen is 90%. The evidence demonstrates the association between congenital omphalocele and maternal tobacco and alcohol consumption. Women consuming multivitamin pills, most of which include folic acid, should be informed of the risk of having children with omphalocele, which occurs while the baby is developing in the womb.
|
Clinical case
|
biomedical
|
en
| 0.999999
|
PMC11204484
|
The biggest challenge in current-day implantology is peri-implant diseases, which is a very common condition. Peri-implantitis is described as a pathological state that arises in the tissues surrounding dental implants. It is marked by inflammation within the connective tissue around the implant and progressive bone loss, extending beyond the normal physiological adaptation period . Besides a prior occurrence of periodontal disease, smoking, inadequate oral care and systemic diseases, the absence of keratinized mucosa (KM) surrounding the implant is mentioned as a contributing factor to peri-implantitis . Bassetti et al. , considering the limitations of their review, concluded that depending on the localization and the clinical situation, different surgical augmentation techniques of KM can be used. The maxilla apically positioned partial-thickness flap (APPTF) to gain KT and the roll envelope flap (REF) to gain soft tissue volume are efficacious and minimally invasive techniques. In the mandible, to gain KT, the employment of APPTF in combination with a free gingival graft (FGG) or a xenogeneic graft material (XCM) are both highly predictable, although soft tissue substitutes increase the expense of the treatment. A review of the literature was performed to check the state of knowledge regarding the association between the lack of KM and peri-implantitis. The search was conducted on 11 May 2024 in the most popular database—PubMed (Medline). The following keywords were used during the search process: “peri-implantitis” AND (“keratinized mucosa” OR “attached mucosa” OR “attached gingiva” OR “free gingival graft” OR “apically positioned partial-thickness flap”). To ensure the highest quality of review, only cohort studies, case-control studies and randomized clinical trials were included in the search. Nevertheless, no suitable records were found, and therefore, meta-analyses and systematic reviews were included in this literature review, which is ultimately narrative in nature. The flow diagram is presented in Figure 1 . The decision to proceed with immediate implant placement was determined by the quality and quantity of the remaining bone, which supported this approach. Lee et al. , in a systematic review and meta-analysis, concluded that placing implants immediately in extraction sockets with periapical infections is viable with careful debridement and adherence to appropriate surgical protocols. Several investigations uphold this point of view . Consequently, after oral hygiene education, the treatment plan was settled as follows: Extraction of hopeless teeth and enucleation of periodontal lesions with immediate implantation in the positions of teeth 32, 34, 42, 44 and bone augmentation; After two months of evaluation of soft tissues and possible augmentation of them using free gingival graft/grafts; Bar retained overdenture as the final restoration. Implant size and location were established using iRYS software (version 10.0) for CBCT radiographs (MyRay, Hyperion X5 3D, Cefla s.c., Imola, Italy). Preoperative antibiotic prophylaxis includes administering Clindamycin 600 mg one hour prior to surgery, followed by a postoperative regimen of 300 mg every eight hours for six days. For economic reasons, the temporary restoration patient chose a removable full denture. The surgery was executed under local anesthesia using articaine with adrenaline (Dentocaine 40 mg/mL + 0.01 mg/mL; Laboratorios Inibsa, S.A.; Lliçà de Vall, Spain). All teeth were extracted, and full-thickness buccal and lingual flaps were performed. In order to achieve better conditions for implantation, alveolar osteoplasty was performed. With great precaution due to the proximity of the mental nerve, the periodontal lesions were enucleated. Four implants with a diameter of 3.75 mm and a length of 10 mm were inserted 1 mm subcrestal in relation to the buccal bone (ICX-Active Master implant, Medentis medical, Bad Neuenahr-Ahrweiler/Germany). Primary stability was 34 Ncm, 10 Ncm, 30 Ncm and 28 Ncm for implants in the position of teeth 32, 34, 42 and 44, respectively. Moreover, 6 mm high healing screws were fixed to the implants. Bone defects resulting from periodontal lesions removal were augmented by bovine-derived xenograft (Bio-Oss 0.25–1 mm; Geistlich; Wolhusen, Switzerland) mixed with autogenous bone collected from the left side of the mandible using a scraper, outside implantation area. The flaps were repositioned using simple non-resorbable 5/0 nylon sutures (Seralon, Serag-Wiessner, Naila, Germany) . After surgery, CBCT evaluation was assessed . After the administration of local anesthesia utilizing articaine with adrenaline (Dentocaine 40 mg/mL + 0.01 mg/mL; Inibsa Dental S.L.U.; Spain), 1 mm depth incision along the mucogingival junction on the buccal side of the implants was made. Two vertical incisions, each measuring 10 mm, were made through the alveolar mucosa at the ends of the horizontal incision. A flap of partial thickness was elevated and positioned apically using simple resorbable 5/0 polyglycolic acid sutures attached to the periosteum (PGA, Atramat, Ciudad de México, Mexico). From both sides of the hard palate in the region from the canine to the first molar of the maxilla, two free gingival grafts of a thickness of 1.5 mm and dimensions of 6/25 mm were collected according to the measurements made by the periodontal probe. The first follow-up was conducted after 1 month, and the last one occurred after 24 months. All implants survived, and KM thickness increased on the buccal side by approximately 2 mm . The functionality of the mental nerve remained intact. Under the bar, plaque was detected; nonetheless, no symptoms of peri-implant soft tissue inflammation were observed. All implants presented a probing depth from 2 to 3 mm, and there was no bleeding on probing. Moreover, the orthopantomogram revealed no bone resorption . Patient oral hygiene education was repeated. This narrative review revealed that three of nine studies identified the lack of keratinized mucosa as a risk factor for developing peri-implantitis. Brito et al. concluded that the presence of an appropriate zone of keratinized tissue results in better peri-implant tissue health, which is consistent with the research of Thoma et al. and Stefanini et al. . Carra et al. recognized KM augmentation procedures as favorable for the control of peri-implant inflammation and the stability of marginal bone levels. In contrast to previous studies, Dreyer et al. stated that there is no convincing evidence available that the absence of keratinized mucosa (KM) is one of the risk factors for peri-implantitis. According to this systematic review, smoking, diabetes mellitus, inadequate prophylactic measures, and a history or existing condition of periodontitis are the primary risk factors most crucial for peri-implantitis. In addition, Revida et al. concluded that the influence of keratinized mucosa width on the development of peri-implantitis appears to be negligible. Subsequently, using only the keyword “keratinized mucosa” in PubMed (Medline), it is possible to find many other studies describing the influence of KM presence on soft tissue health surrounding the implant. Most investigators agree that KM is crucial for peri-implant health. The authors consider the importance of the KM in terms of the following parameters: gingival index score, plaque index score (plaque accumulation), bleeding scores, radiographic bone loss, periodontal attachment loss and mucosal recession. In a cross-sectional study, Bouri et al. declared that implants with a lack of keratinized mucosa (<2 mm) had a significantly higher mean gingival index score, plaque index score and radiographic bone loss. Schrott et al. examined 386 mandibular dental implants placed in 73 completely edentulous patients and restored with fixed full-arch prostheses. They concluded that the lack of adequate KM (<2 mm) had an influence on plaque accumulation and bleeding scores; however, this was only on lingual sites. In Adibrad et al.’s study on 66 functioning dental implants supporting overdentures, the mean gingival index score, plaque index score and bleeding on probing were significantly higher for those implants with a narrow zone (<2 mm) of KM. Moreover, implants with a wider KM zone (≥2 mm) were related to less periodontal attachment loss and mucosal recession . Zigdon et al. also explored the impact of keratinized mucosa (KM) on the condition of the tissues surrounding the implant. They assumed that a wider mucosal band (>1 mm) was associated with less mucosal recession compared with a narrow (<1 mm) band. Also, a wider KM band was associated with greater probing. Consequently, the authors concluded that the KM around dental implants affects both the clinical and the immunological parameters at these sites. Lin et al. , in their systematic review and meta-analyses, extracted mainly from cross-sectional studies, stated that the presence of at least 1–2 mm wide KM might be favorable in decreasing plaque accumulation, tissue inflammation, attachment loss, and mucosal recession. Chung et al. stated that the absence of adequate keratinized mucosa (KM) or attached mucosa (AM) in dental implants, especially in posterior implants, is associated with higher plaque accumulation and gingival inflammation but not with more annual bone loss, regardless of their surface configurations. Oh et al. examined free gingival grafts and their impact on crestal bone loss around implants. They stated that FGG for implants exhibiting a lack of KM is a viable treatment option to reduce mucosal inflammation and to maintain crestal bone level in the short term. Kim et al. reached different conclusions regarding the impact of KM on hygiene around implants. They found that in cases with a lack of KM in the vicinity of implants, its deficiency does not necessarily have an adverse effect on hygiene management and soft tissue conditions. Nevertheless, the risk of an increase in gingival recession and crestal bone loss is present. Therefore, it is thought that from the aspect of long-term preservation and management, as well as for the area demanding esthetics, the presence of an appropriate volume of keratinized gingiva is required . Furthermore, Fons-Badal et al. noticed that after non-surgical treatment, implants surrounded by keratinized gingiva demonstrated superior outcomes. A history of periodontal disease is also mentioned as one of the risk factors for peri-implantitis. Derks et al. clinically and radiographically examined 588 patients who all had received implant-supported therapy 9 years earlier. They reported that 45.0% of all patients presented with peri-implantitis (bleeding on probing and bone loss >0.5 mm), and 14.5% of diagnoses were severe peri-implantitis (bleeding on probing and bone loss >2 mm). Furthermore, they concluded that patients with periodontitis and with ≥4 implants, as well as prosthetic therapy delivered by general practitioners, presented higher odds ratios for moderate peri-implantitis. A systematic review by Carra et al. concluded that in partially edentulous patients receiving an implant-supported fixed partial denture, a history of periodontitis is associated with a poorer survival rate and an increased risk of peri-implantitis over a 5–10-year follow-up period after implant loading.
|
Other
|
biomedical
|
en
| 0.999997
|
PMC11279322
|
Malassezia furfur is a lipophilic, yeast-like fungus that normally colonizes the human skin as commensal organism. This fungus mainly causes a wide spectrum of cutaneous diseases, although in recent years the number of reports of invasive infections caused by this fungal pathogen is constantly increasing . M. furfur is the most encountered species from bloodstream infections within the Malassezia genus, followed by M. pachydermatis and M. sympodialis , especially in premature neonates and immunocompromised hosts [ , , ]. Intravenous injections via a central venous catheter (CVC) represents the major risk factor for systemic Malassezia infections in both adults and neonates, followed by total parenteral nutrition (TPN) and invasive procedures . A 22-year-old Caucasian male affected by T-ALL (deletion of the long arm of chromosome 6), in treatment with Navitoclax plus Venetoclax-based savage therapy from the last months (Day −30) was admitted to the Emergency Department of our tertiary care University hospital (Day 0) with pleuritic chest pain, dyspnea, and fever that started 3 days prior to admission. He was hospitalized a week earlier at a different medical center for routine treatment of T-ALL through CVC (Groshong line) (Day −7). No recent contact with domestic animals or new drug intake were reported. At the admission in our center (Day 0), the patient presented a weight of 55 Kg and height of 180 cm. Physical examination of the patient revealed a temperature of 37.9 °C, blood pressure 121/76 mmHg, pulse 87 beats/min, and respiratory rate of 16 breaths/min with an oxygen saturation of 98 %. Blood tests revealed Hb 7.6 g/dL, Platelets 7.000/mmc, White Blood Cells 1.580/mmc, Neutrophils 720/mmc. High resolution chest computer tomography (CT) showed a pleural effusion layer on the left with a maximum thickness of 23 mm at the basal site, with a concomitant minimal amount of contiguous atelectatic parenchyma. Limited “ground glass” areas of altered parenchymal density in the right middle lobe, suggesting for T-ALL progression. The main airways are patent. He was admitted to the hematological ward for pleural drainage, receiving TPN and follow-up monitoring. Due to the clinical suspicion of a systemic infection in course of neutropenic fever, three sets of peripheral blood cultures (Day 0) and three from the CVC were collected to detect microbial pathogens by using the BacT/Alert Virtuo® automated system (VIRTUO™, bioMérieux Inc., Hazelwood, MO). Aerobic blood culture from CVC were positive 4.3 hours after incubation. In parallel, blood smear microscopic examination of collected cultures from CVC and peripheral blood revealed the presence of Gram-positive bacilli and rare yeast-like cells . The ePlex® system, a double molecular diagnostic test, was used for a rapid identification of bacterial and fungal species. While the Gram-positive panel (ePlex® BCID-GP) revealed the presence of B. cereus , no fungal pathogens were detected by the ePlex® BCID Fungal Pathogens Panel. Given the suspicion of bloodstream co-infections by bacteria and fungi, we carried out sub-cultures on Sabouraud dextrose agar (SDA) and on Agar chromID™ Candida (CAN2) at 25 and 37 °C from positive blood samples. The patient was treated intravenously (IV) with piperacillin/tazobactam at a dose of 4,5 g q6h and fluconazole 400 mg/die. On the same day, urine cultures for bacterial and fungal infections were negative nor serum galactomannan and procalcitonin measurements. The (1,3)-β-D-glucan measurement in blood resulted indeterminate. Fig. 1 Gram stain smear from blood samples at Day 0 shows the presence of Gram-positive small cells, elliptical in shape (red arrow) and Gram-positive slender bacilli with rounded ends, arranged singly in short chains (blue arrow) (A); Gram-positive yeast-like cells from blood smear (B). Lactophenol blue wet mount of a portion of the colony on CAN2 (Day 14) shows spherical to elliptic yeast-like cells and short pseudohyphal elements with several monopolar budding cells (C). All images are at 100x magnification. Fig. 1 On Day +4, considering the clinical improvement but the lumbar pain, magnetic resonance imaging showed minimal edematous imbibition of the paravertebral muscles in the lumbar region. As a lateral finding, the presence of left pleural effusion (6mm) was reported. On Day +7 there was a relapse of the T-ALL due to the reappearance of a circulating blast rate equal to approximately 50 %. On Day +9, vincristine 2 mg was administered for cytoreductive purposes in association with steroid plus Navitoclax and Venetoclax. After 11 days (Day +11), on CAN2 plate incubated at room temperature, few large white-pale pink and wrinkled colonies developed but direct Matrix Assisted Laser Desorption/Ionization-Time of Flight mass spectrometry (MALDI-TOF MS) Biotyper® (Bruker Daltonics, Bremen, Germany) identification failed in identifying the microorganism, suggesting a Malassezia furfur with low score (1.20). According to the suggestion, a subculture on SDA supplemented with filtered olive oil (SDAO) was made to evaluate the possible isolation and growth of Malassezia . The patient presented a slight clinical improvement until Day +14, when MALDI-TOF MS analysis was re-performed on the fungal culture and allowed us to identify the fungus as M. furfur (score 1.98). On the same day (Day +14), lactophenol blue mount made from a portion of the colony on CAN2 showed spherical to elliptical and teardrop-shaped yeast cells with short pseudohyphal elements and several monopolar budding cells . Daily doses of liposomal amphotericin (L-amB), at 3 mg/kg IV, were administered while the treatments with fluconazole and piperacillin/tazobactam were stopped due to negative blood cultures for B. cereus by BacT/Alert Virtuo® automated system. Traditionally, Malassezia identification has relied on culture-based methods, by examining morphological and biochemical characteristics, i.e., the use of tweens and chromophore EL™, catalase activity, and growth at different temperatures . However, these conventional microbiological approaches present some limitations. They struggle to differentiate between closely related species, are time-consuming, and have a high error rate. As a result, Malassezia -related disorders and infections are likely to be underdiagnosed in routine clinical laboratories. This is because standard non-lipid supplemented media, like Sabouraud glucose agar ( SGA ), do not support the growth of Malassezia and, therefore, delay the correct identification and treatment. Furthermore, the lack of species-level identification hampers our understanding of the epidemiology of Malassezia -related disorders and infections [ , , ]. For these reasons, during the last five decades molecular based approaches and methods that identify the chemical imprint of the different species e.g., different Polymerase Chain Reaction (PCR) techniques, MALDI-TOF MS, as well as Raman spectroscopy have been applied to achieve fast and accurate fungal identification, including yeast fungi as Malassezia . Despite that, the majority of the studies were focused on the cutaneous detection of Malassezia , while fast microbiology in systemic infections is negligible. In line with our case , other authors have previously demonstrated that M. furfur fungemia can often be missed by the automated blood culture system BacT/Alert®. Particularly, out of 9 M. furfur fungemia cases reported by Iatta et al. , only 1 case of M. furfur fungemia was detected by the BacT/Alert® system. Also, Tetsuka et al. have reported a case of M. furfur blood infection in a 3-year-old boy detected on blood-smear and not identified by automated blood culture systems. The low detention rate by automated systems could be due to the cytotoxic effect of human blood on yeast growth . It has been demonstrated that the addition of 3 % palmitic acid in the hemoculture bottles might be able to overcome the inhibitory effect of both small (0.5 mL) and large (3 mL) volumes of blood, favoring Malassezia growth . Finally, although molecular tools have been used to detect Malassezia yeasts from biological samples, no studies are reported in the literature on the molecular identification of Malassezia from direct blood specimens. Thus, traditional direct microscopy and culture methods remain the gold standard for the detection of M. furfur . The lack of cutaneous tests to confirm the presence of Malassezia on the skin of our patient and the lack of antifungal susceptibility testing for M. furfur are some limitations of this study . Moreover, in this study the co-infection by B. cereus did not allow us to establish if the patient's death was attributable to bacteremia or fungemia or both. In conclusion, M . furfu r fungemia often remains undetermined by using automated blood culture systems. In our case, the direct microscopic examination of positive blood cultures, for the concomitant infection by B. cereus, helped us in diagnosing of systemic fungal infection that was confirmed as Malassezia bloodstream infection by traditional culture-based method and proteomic analysis by MALDI-TOF MS. Conversely, neither the automated blood culture system BacT/Alert Virtuo®, nor molecular methods were able to detect the presence of the fungus in the blood. Thus, there is unmet need for novel diagnostic tools to allow a rapid identification of this fungus from direct blood sample that is crucial for appropriate therapeutic interventions.
|
Study
|
biomedical
|
en
| 0.999998
|
PMC11343066
|
Before the era of effective antitubercular therapy and bronchoscopy, endobronchial tuberculosis (EBTB) was a severe healthcare issue, often leading to airway stenosis and atelectatic lung . EBTB frequently affects children, with around 40% of total cases of pulmonary tuberculosis reported in the pediatric population. EBTB frequently leads to complications such as airway stenosis or obstruction, resulting in a hampered quality of life and may sometimes even be fatal . With the increased use of diagnostic bronchoscopy and effective antitubercular treatment, the occurrence of complications of EBTB has significantly declined. However, it remains a challenging situation for pediatric patients. In this report, we present an interesting case of a two-year-old male, a known and operated case of yolk sac testicular tumor, who presented with a collapse of the right middle lobe of the lung observed in a follow-up PET-CT scan. Flexible bronchoscopy helped in the visualization of an endobronchial mass, and a forceps biopsy of the same ruled out any metastasis from the previous disease, confirming the diagnosis of EBTB. To prevent the grave complications of EBTB, a close follow-up and, if necessary, an intervention might be essential, specifically in the tumorous variant of EBTB . A two-year-old male, a known case of yolk sac testicular tumor, presented to the pediatric outpatient department for a regular follow-up. He had undergone a right orchidectomy a year ago and had received one cycle of chemotherapy with PEB (cisplatin, etoposide, and bleomycin) postoperatively. The child was now asymptomatic, and a thorough clinical examination was also done, which showed normal vitals, normal height and weight for age, and no palpable lymph nodes. He was then advised to get a PET-CT to check for any metastatic foci or local site recurrence. Surprisingly, the PET-CT showed fluoro-deoxy-glucose (FDG)-avid heterogeneously enhancing interfissural oblong consolidatory mass in the right middle lobe of the right lung measuring 1.3 x 2.1 x 3.7 cm with a maximum standard uptake value (SUV max) of 8.0. There were also mild FDG-avid uptakes in the right paratracheal and subcarinal lymph nodes, the largest measuring 0.7 x 0.7 cm with an SUV max of 4.0. The rest of the scan showed no definite evidence of any metabolically active foci/enhancing lesion in the postoperative site of the right scrotum to suggest residual or recurrent malignant disease . The patient's serum alpha-fetoprotein levels were 0.804 ng/mL (normal range 5-10 ng/mL), and his beta-HCG level was less than 2.39 (normal); the rest of the routine blood investigations revealed no significant abnormality. He was planned to be taken up for flexible bronchoscopy-guided biopsy from the lung lesion with a thin bronchoscope of 3.0 mm outer diameter under general anesthesia. The bronchoscopy showed an endobronchial mass with a caseous material at the tip of the lesion arising from the postero-lateral wall of the right intermediate bronchus abutting the lumen of the middle lobe bronchus, leading to the collapse of the middle lobe; also, retained thick secretions were seen oozing out from the middle lobe bronchus . A forceps biopsy was taken from the mass and sent for histopathological examination and bronchoalveolar lavage was also taken from the right lung all segments and was sent for Ziehl-Neelson staining and Cartridge-Based Nucleic Acid Amplification Test (CBNAAT). The AFB staining and CBNAAT turned out to be negative, but the biopsy sample of the endobronchial growth showed aggregates of epithelioid histocytes, giant cells, mononuclear inflammation, and necrosis, suggesting necrotizing granulomatous inflammation, likely to be tuberculosis. The biopsy sample did not show any evidence of malignancy or metastasis . According to Jung et al., EBTB can affect any part of the tracheobronchial tree, with the primary bronchi, superior lobar bronchi, and right middle lobar bronchus being the most commonly affected sites. The researchers classified EBTB into three types: single-level, multiple-level, and central EBTB. Single-level EBTB involves only one part of the trachea, main bronchus, or lobar bronchus . Multiple-level EBTB affects two or more bronchial levels . Central EBTB, occurring proximal to the lobar bronchi, has the highest potential for developing symptomatic stenosis . As per a study by Jiao et al., patients under five years are at higher risk of developing EBTB as a complication of primary tuberculosis with multiple endobronchial lesions, most frequently presenting as the tumorous type, that too in the right bronchial system, as in our case. In suspected patients, flexible bronchoscopy should be performed at the earliest to detect such endobronchial lesions . The complications related to EBTB include bronchial stenosis or stricture formation, severe airway obstruction or respiratory failure when central airways are involved, post-obstructive bronchiectasis with frequent pneumonia and hemoptysis, and persistent obstructive airway disease . More than 90% of testicular cancers arise from germ cells and are divided into seminomas (SGCTs) and non-seminomas (NSGCTs). NSGCTs mainly include embryonal carcinoma, yolk sac carcinoma, choriocarcinoma, and teratoma . Although the chest commonly hosts metastases from testicular tumors, only seven endobronchial metastasis (EBM) cases have been reported till now, making it an extremely rare phenomenon . Chung et al. have provided a classification of the subtypes of EBTB based on bronchoscopic features (Table 1 ) . Given our patient’s history of a yolk sac tumor in the right testis, our primary differential diagnosis was endobronchial metastasis. The patient was asymptomatic, with findings observed only on PET-CT. This report highlights the widespread prevalence and varied presentation of tuberculosis and underscores the importance of bronchoscopy in early diagnosis and prompt antitubercular treatment to prevent serious EBTB complications. We recommend performing bronchoscopy in all children presenting with a lobar lung collapse on radiologic studies or with a clinical picture of an endobronchial mass.
|
Review
|
biomedical
|
en
| 0.999997
|
PMC11434283
|
Subarachnoid hemorrhage (SAH), caused by the rupture of a fusiform vertebral artery dissecting aneurysm (VADA), is a well-known but rare disease representing approximately 3% of all intracranial aneurysms . Although good-grade patients with ruptured VADAs usually exhibit a better clinical course, the overall patient outcomes after discharge are poor compared to patients with other saccular aneurysmal SAHs . This is of particular association with the higher rebleeding rate seen with ruptured VADAs (40.5% within 24 h of initial SAH) than with other saccular aneurysms . Furthermore, vasospasm or related delayed cerebral ischemia due to thick and diffuse SAH may also become an additional risk factor for worsened prognosis , although the prevalence of ruptured VADA is unknown. An endothelin receptor antagonist clazosentan has demonstrated efficacy in reducing the incidence of moderate to severe angiographic vasospasm and its related delayed cerebral ischemia and morbidity . Currently, clazosentan has become the first-line drug for the prophylactic management of vasospasms in patients with postoperative SAH in Japan . According to a recent meta-analysis and systematic review, clazosentan may be regarded as a valuable adjunctive drug in managing postoperative SAH patients , being beneficial in a high-risk population for vasospasm with thick and diffuse SAH . The amount of clinical data regarding clazosentan anti-vasospasm therapy for ruptured aneurysms in the anterior circulation has increased substantially . However, the features of the posterior circulation, particularly in patients with a ruptured VADA, have not been reported to date. Therefore, we believe it is important to share our clinical experience of treating post-SAH symptomatic vasospasm with clazosentan following ruptured VADA. Herein, we report a case of mild-grade SAH in a patient who successfully underwent endovascular internal trapping of the ruptured VADA, which resulted in a poor clinical outcome due to severe symptomatic vasospasm refractory to clazosentan and subsequent post-SAH hydrocephalus. In this report, we further analyzed the Hounsfield unit (HU) values of serial head computed tomography (CT) scans as a surrogate quantitative parameter of the subarachnoid clot volume and clearance for predicting vasospasms and hydrocephalus , and compared them with those of a contrasting case where a good clinical course was observed. This article was written in accordance with CARE (CAse REport) guidelines . A 49-year-old man was brought to a tertiary hospital with the sudden onset of headache after alcohol consumption. On arrival, his level of consciousness was 15 on the Glasgow Coma Scale with no abnormal neurological findings. A CT scan of the head showed an SAH in the bilateral Sylvian fissures and basal cisterns , being compatible with World Federation of Neurosurgical Societies (WFNS) clinical grade 1 (mild-grade SAH) and modified Fisher grade 3 (thick and diffuse SAH). Subsequent CT angiography of the brain revealed a left VA aneurysm . The patient was then transferred to a stroke center for further treatment. A left fusiform dilating aneurysm with a “pearl and string sign” was diagnosed using digital subtraction angiography (DSA) . The VADA was located at the co-dominant side and distal to the posterior internal cerebral artery. Therefore, we selected VA coil trapping as a first treatment , and internal trapping was successfully performed under general anesthesia . Clazosentan (10 mg/h) was initiated on day 1, and no other anti-vasospasm therapies such as oral cilostazol and/or intravenous fasudil hydrochloride were used. The postoperative course was uneventful, with mild headache and low-grade fever. Lumbar drainage (30 mL) was performed on day 4, with no remarkable elevation in the cerebrospinal fluid (CSF) pressure (6 cmH 2 O). However, on day 9, the patient abruptly developed left-sided weakness and hemispatial neglect consistent with a vasospasm in the right middle cerebral artery (MCA) territory, which was confirmed by DSA and treated with intra-arterial fasudil and balloon angioplasty . Institutional medical treatment for mild hypervolemia and dobutamine-induced hyperdynamic therapy were ineffective. While the symptoms resolved, the patient developed aphasia the following day. Endovascular therapy was repeated for the vasospasm-affected left MCA territory . A 49-year-old man was brought to our hospital with a sudden onset of headache. His level of consciousness was 14 on the Glasgow Coma Scale, with no abnormal neurological findings. A head computed tomography (CT) can showed thick and diffuse SAH and intraventricular hemorrhage , corresponding to WFNS grade 2 and modified Fisher grade 4). CT angiography demonstrated a left VADA located distal to the posterior internal cerebral artery , which was successfully treated by endovascular VA coil trapping . He received clazosentan for 14 days from day 1 after SAH onset. In contrast to the aforementioned case, his postoperative course was uneventful, without angiographic evidence of vasospasm or recanalization of the VADA , and he was discharged at 1 month with a modified Rankin scale of 0. In view of the brain CT imaging for both cases in the same time frame, relatively higher clot densities could be observed until the occurrence of vasospasm . Therefore, we retrospectively analyzed the HU values of the subarachnoid space on serial CT scans by dividing it into the basal and Sylvian cisterns because high HU values on initial CT at admission were significantly correlated with the incidence of symptomatic vasospasm (both cisterns), hydrocephalus (basal cistern), and long-term prognosis in mild-grade SAH treated with endovascular coiling . The HU values for both of the basal and Sylvian cisterns in this patient remained high until the occurrence of a vasospasm, whereas the values in the other case were low at onset and declined and a good clinical course followed without vasospasm. To the best of our knowledge, this is the first report of severe symptomatic vasospasm refractory to clazosentan anti-vasospasm therapy in a patient with mild-grade SAH after a ruptured VADA treated with endovascular coiling. In a recent reanalysis of the CONSCIOUS trials, the therapeutic dose of clazosentan (15 mg/h) reduced vasospasm-related morbidity at 6 weeks in a population with thick and diffuse SAH by 19% compared to a placebo (36%), with a relative risk of 0.54. However, there was still a lack of apparent positive effects on 3-month survival and clinical outcomes . It should be noted that this study was conducted in patients with an aneurysmal SAH located in the anterior circulation (93%); cases of such patients with VADAs have not been reported, with only three cases located in the “distal VA”. It is well established that extensive subarachnoid clots have prognostic significance . Thus, they form the basis of the modified Fisher scale for predicting the risk of symptomatic vasospasm and delayed cerebral ischemia. In studies reporting the effects of clazosentan, an SAH clot was defined as diffuse (long axis ≥ 20 mm or present in both hemispheres; secured by surgical clipping) or thick (short axis ≥ 4 mm; secured by endovascular coiling) on the CT scan at admission. However, the impact of the location and form of the aneurysm on the clazosentan efficacy remains to be examined because similar VADA cases with thick and diffuse SAH have demonstrated good clinical outcomes without vasospasm. In a recent study, measuring the HU values provided a more objective assessment for predicting symptomatic vasospasm and hydrocephalus independent of patient-specific factors such as age or interobserver variability . When we used the reported HU values in the basal cistern to predict vasospasm (cutoff value, 44.9; sensitivity, 62%; specificity, 66%; p = 0.001) and hydrocephalus (46 versus 40 with and without its incidence; p = 0.016) in the present VADA-SAH case, it was determined that our patient had a higher risk for both complications than the other case with a good outcome. In addition, the persistence of high HU values is associated with the development of vasospasms, compared to HU values that dropped rapidly. However, the clot volume and clearance rates could not be accounted for. Importantly, serial HU measurements can be performed in patients after ruptured aneurysms treated within the posterior circulation, with little or no metal artifacts (i.e., coil, stent and clip) is considered for the analysis. Considering the persistently high HU values in the subarachnoid space, more pre-emptive CSF diversion might have facilitated clot volume reduction and clearance, irrespective of the management of elevated intracranial pressure. Nevertheless, our case suggests that attention should be paid to the post-SAH clot density on admission and its serial changes, even in patients with good-grade SAH. Moreover, the higher rebleeding rate of VADA may increase the incidence of thick and diffuse clot formation in the subarachnoid space, leading to severe symptomatic vasospasm refractory to clazosentan, which can abruptly worsen the patient’s condition. Angiographically, clazosentan has shown to dilate vasospastic vessels at 24 h after starting intravenous administration in most cases, particularly in the distal arterial beds. By contrast, it achieved the reversal of large vessel vasospasm in only 27.3% of the patients . Similar results have also been demonstrated in a recent Japanese single-center, observational study to compare clazosentan with a conventional protocol of oral cilostazol and intravenous fasudil hydrochloride, where clazosentan had a lower incidence of distal artery spasm (14% vs. 34%; p = 0.002) without significant differences in the proximal arteries (19% vs. 23%; p > 0.05) . Indeed, there exists many biological complexities and multiple mechanisms regarding how SAH affects the brain and cerebral circulation . Therefore, the limited effectiveness of clazosentan on vasospasms induced by a ruptured VADA or massive SAH clot volume should be clarified in future studies in larger populations, which may contribute to the disconnection between an effective treatment for large-artery vasospasms and clinical outcomes .
|
Study
|
biomedical
|
en
| 0.999997
|
PMC11585352
|
Anesthesia is a cornerstone of modern dermatological practice, facilitating a wide range of procedures from simple excisions to more advanced interventions like laser treatments and Mohs micrographic surgery . The role of anesthesia extends far beyond its traditional function of providing analgesia; it influences several critical aspects of dermatological outcomes, including wound healing, infection control, cosmetic appearance, and patient satisfaction . As dermatologic procedures continue to evolve, the choice of anesthesia has become increasingly nuanced, potentially impacting the quality of care and the overall patient experience . This review aims to comprehensively examine the impact of various anesthetic techniques on dermatologic outcomes. By delving into their effects on wound healing, infection rates, pain management, cosmetic results, and potential complications, this paper seeks to offer a broad perspective on the current state of anesthesia in dermatology. Furthermore, the review will highlight emerging trends, such as personalized anesthesia and minimally invasive techniques, while identifying areas where further research is needed. Ultimately, this discussion aims to equip dermatologists with the knowledge to make informed anesthetic choices that enhance patient outcomes and satisfaction. Knowledge of the various types of anesthetics allows physicians, including dermatologists, to select the appropriate method and agent to keep their patients safe while obtaining optimal results. Topical anesthetics work by blocking the conduction of nerve impulses in sensory nerves through the inhibition of voltage-gated sodium channels in the neuronal membrane, essential for initiating and propagating action potentials. When applied, these anesthetics, such as lidocaine or benzocaine, penetrate the skin to reach sensory nerve endings. They diffuse through the neuronal cell membrane, binding to sodium channels in their inactivated state, thereby preventing sodium ions from entering the neuron. This blockage is crucial for nerve depolarization and the generation of action potentials. Without the influx of sodium, the neuron cannot reach the threshold potential necessary for initiating and transmitting nerve signals, resulting in localized numbness or analgesia. The effect of this blockade is reversible; once the anesthetic is metabolized or removed, normal nerve function resumes. Since these anesthetics primarily act on peripheral sensory nerves, they provide localized pain relief in the application area without affecting deeper tissues or having systemic effects, making them ideal for minor skin procedures and pain management in superficial skin lesions . Due to their percutaneous application, topical anesthetics must penetrate the epidermis, which acts as a barrier to deeper layers such as the dermis, where the targeted nerves and blood vessels lie . They are typically reserved for very superficial procedures . Some of the most common topical anesthetic agents that penetrate intact skin include a eutectic mixture of local anesthetics (EMLA), ELA-Max, amethocaine, and lidocaine in acid mantle or velvachol. EMLA, containing lignocaine and prilocaine, is applied to the skin in a thick layer before covering the area with an occlusive dressing such as plastic wrap or Tegaderm to facilitate penetration . It is recommended that EMLA be applied at least 1 hour before minor procedures . EMLA reaches its peak effect at 2-3 hours, and the duration of its anesthetic effect can be influenced by the surface area covered; larger surface areas may enhance absorption and prolong its activity. Once removed, it continues to exert an anesthetic effect for 1-2 hours . ELA-Max, which contains lidocaine, only requires 15-40 minutes following application to take effect . Amethocaine, which is 4% tetracaine, also requires application under an occlusive dressing. Due to its lipophilic properties, Amethocaine has a faster onset of action, 40 minutes, and a duration of action of 4 hours, compared to EMLA . Topical lidocaine does not penetrate the epidermis as readily as tetracaine and therefore requires higher concentrations (30-40%), such as those seen in lidocaine with acid mantle or velvachol used as a means for application . Local anesthetics have a similar mechanism of causing analgesia by inhibiting sensory nerves from transmitting signals. However, they are typically injected into the tissue and anesthetize a larger surface area than topical agents . The human body contains various types of nerve fibers, including C fibers, which are unmyelinated and transmit pain signals slowly, and A-delta fibers, which are myelinated and responsible for the rapid transmission of sharp, acute pain. Local anesthetic exerts most of its effect on these A-delta fibers, effectively blocking pain detection but potentially allowing a patient to continue to feel pressure and vibration, whereas C fibers are relatively resistant . Selection of the appropriate local anesthetic largely depends on the goal of the procedure and physician preference, but knowledge of the various agents available is essential. The most common local anesthetic is 1% lidocaine with epinephrine in a concentration ratio of 1:200,000 because of its quick onset and excellent safety profile . For a longer duration, etidocaine and bupivacaine are more likely to be appropriate. There are various techniques to consider when using local anesthetics, including infiltrative and tumescent techniques. Infiltrative anesthesia is typically administered at a depth of approximately 3 to 5 mm below the skin surface. This depth targets the dermis and superficial subcutaneous tissue, ensuring that the anesthetic reaches the nerve endings responsible for sensation in the area . Then, the physician may progressively expand the anesthetized area by passing the needle through previously anesthetized tissue. This dramatically improves the patient’s comfort and tolerance of the procedure . Tumescent local anesthesia is similar to infiltrative anesthesia, except it utilizes a high volume of diluted local anesthetic agent to inject the desired area . Epinephrine may also be added to the injected solution, but this can increase the patient's uncomfortable burning sensation. To lessen the patient’s discomfort, sodium bicarbonate is also commonly added, with the proper ratio being 1 mL of sodium bicarbonate (8.4%) to 10 mL of local anesthetic solution . Most dermatologic procedures are performed using local anesthesia for a variety of reasons. It has been shown that general anesthesia, when the patient is completely sedated, paralyzed, and intubated, carries a greater risk of adverse events than local anesthesia . General anesthesia is typically reserved for more invasive dermatological procedures or circumstances that require sedation. It may be necessary for MMS that requires the removal of multiple lesions, deep excisions, or complex reconstructions . General anesthesia may be considered for patients who suffer from extreme anxiety or a phobia of medical procedures . It is frequently necessary for pediatric cases due to the limited ability of the patient to cooperate during the procedure . The literature shows that, while general anesthesia for elective pediatric dermatology cases carries a low risk when managed by a skilled anesthesiologist, its use in adult patients is significantly more costly and associated with higher complication rates . The decision to use general anesthesia for a Mohs procedure should be made on a case-by-case basis, considering the patient’s individual needs and the nature of the procedure. In dermatologic procedures, it is a common technique to inject local anesthetic directly into the wound to minimize patient discomfort. There are three stages of wound healing: inflammation, granulation, and remodeling. Local anesthetics have been shown to disrupt the first and second stages of wound healing . Despite this, some studies have shown no long-term alteration in wound healing with the addition of local anesthetic because the strength of the wounds is normal . Studies have also evaluated the effect of topical anesthetics on wound healing in mice, and they show no significant hindrance to wound healing . It has been shown that patients who receive regional anesthesia peri-operatively to control post-operative pain have reduced tissue Po2. Neutrophils depend on subcutaneous Po2 to kill infectious organisms. Therefore, pain control might increase the patient’s risk of infection . It was also previously stated that local anesthetics inhibit the first two stages of wound healing, the first being inflammation. Local anesthetic injection into a patient’s wound has an anti-inflammatory effect that could increase the risk of infection . Local anesthesia adequately improves patients’ post-operative experiences by diminishing incision-associated pain, but the physician must consider the unfavorable effects that accompany their use (Table 1 ). Although relatively uncommon, allergic reactions to anesthetic agents in dermatologic procedures are significant due to their potential severity. Local anesthetics, such as lidocaine and bupivacaine, have been known to trigger hypersensitivity reactions ranging from mild skin rashes to severe anaphylactic shock. The incidence of these allergic reactions is relatively low, with estimates suggesting they occur in less than 1% of patients . Identifying an allergic reaction typically involves a thorough patient history, assessment of clinical symptoms, and, if necessary, allergy testing. Effective management includes discontinuing the offending anesthetic immediately, providing symptomatic relief, and administering emergency treatments like epinephrine and supportive care when needed . Proactive preoperative screening and educating patients about the signs of potential allergic reactions are crucial to reducing these risks. Systemic toxicity from local anesthetics, especially lidocaine, is a severe concern during dermatologic procedures. This toxicity can occur if too much anesthetic is used or if there's an accidental injection into a blood vessel, which can raise plasma levels and lead to systemic effects . Symptoms of toxicity include central nervous system disturbances such as tinnitus and seizures, as well as cardiovascular issues like arrhythmias . Lower concentrations of anesthetics and aspirating before injection can further reduce the risk of systemic toxicity . While high doses of local anesthetic are generally avoided due to the risk of systemic toxicity, there are certain circumstances where they may be necessary. For example, extensive procedures covering large areas of the body will require a higher dose of local anesthetic to achieve adequate pain control. If the procedure is expected to be lengthy, a higher dose may be used to ensure the analgesic effects last the entire duration of the procedure. In emergency situations, local anesthetics are often combined with epinephrine or antifibrinolytic drugs to control bleeding or hemorrhage . Patients may have specific conditions that require a larger dose of local anesthesia, such as patients with hypersensitivity to pain or resistance to local anesthetics. Varying patient factors such as age (children and elderly), sex, pregnancy, concurrent drug use, and other comorbidities such as hepatic impairment and cardiovascular disease may affect the absorption of local anesthetics into the body . Individuals with red hair have been found to require a higher dose of anesthetic to achieve the same level of analgesia as individuals of other hair colors, possibly due to a genetic variation in their MC1R gene . While these situations may warrant higher doses of local anesthetic, it is crucial to weigh the potential benefits against the risks of systemic toxicity. Healthcare providers should carefully consider the patient’s individual factors and the specific procedure before administering a higher dose of local anesthetic. Additionally, providers should calculate doses based on the patient's weight and the anesthetic volume used and monitor the patient closely throughout the procedure . New and emerging topical anesthetics have significantly improved the comfort of dermatological procedures. Topical lidocaine is commonly used in dermatology due to its easy application and low risk of adverse effects. Although effective in reducing discomfort and mild pain during dermatological procedures, healthcare providers must consider the skin's barrier properties and the short duration of action of lidocaine. Research has been directed toward enhancing efficacy and increasing patient satisfaction by developing new drug formulations and delivery systems. Some emerging advances in anesthetic formulations and drug delivery involve the use of nanotechnology, microneedle patches, and laser therapy. Precision medicine is rapidly growing and enables healthcare providers to tailor anesthetic regimens to individual patients, resulting in better clinical outcomes. Anesthetic nanocarriers are nanoparticles composed of natural synthetic/semisynthetic polymers, lipids, or other materials that are used to encapsulate anesthetic drugs to improve their effects . The small size of nanoparticles allows them to effectively penetrate the stratum corneum, the most superficial layer of skin that acts as a barrier for the passage of foreign materials . Depending on their use, nanoparticles can be customized to alter the penetrance of the skin layers, remaining more superficial for topical drugs or penetrating deeper through the skin into the blood vessels for transdermal delivery. Nanoparticle systems can improve topical anesthetic penetrance in the skin without increasing unwanted systematic transdermal transport in outpatient dermatological procedures . The most prevalent types of nanoparticles currently used for cutaneous drug delivery are liposomal nanoparticles, microemulsions (MEs), and polymeric nanoparticles . Nanoparticles containing fixed drug combinations may allow the penetrance of compounds and their synergistic effects into the skin . Liposomes are spherical nanoparticles composed of phospholipids that encapsulate anesthetic drugs. Liposome and ME formulations enhance drug solubility and stability, improving efficacy and reducing irritation. MEs are thermodynamically stable drug delivery systems composed of water, oil, and surfactants. The isotropic dispersion of liquids results in ME nanoparticles of controlled size and morphology . Due to their small droplet size, MEs can penetrate the skin barrier better than other drug delivery systems such as creams, ointments, and gels . MEs may contain nonionic, anionic, or cationic surfactants, depending on their intended application. The composition, charge, and structure of surfactants allow for the customization of drug properties such as penetrance, solubility, and bioavailability . Surfactants reduce the interfacial tension between water molecules and lipophilic molecules in the stratum corneum, which disrupts the skin barrier and furthers skin permeation . MEs enhance skin adhesion and penetration of drugs, allowing them to be used in various dermatological settings. An ex-vivo study found that a depot lidocaine-loaded ME may enhance and prolong the effects of local anesthesia . Microneedle patches are a novel drug delivery system that utilizes tiny needles to penetrate the skin and deliver drugs directly into underlying tissues. Microneedle patches used in combination with anesthetics can increase drug absorption and provide sustained anesthesia. These patches offer several advantages over traditional drug delivery methods, particularly in dermatology. Lidocaine HCl encapsulated dissolving microneedles (LiDMNs) delivered sufficient drug concentrations to maintain anesthesia with a faster onset time and longer residual time than traditional topical cream applications or injections . Microneedle-assisted lidocaine treatment was able to accelerate the onset of action from 40 to 10 minutes, substantially enhancing the efficacy of localized anesthesia . Rapidly separable bubble microneedle patches are a form of microneedle patch that quickly penetrates the skin due to the sheer force of administration, resulting in a convenient and rapid method of delivering anesthetic drugs . The use of a microneedle patch in combination with lidocaine yielded significantly smaller visual analogue scale (VAS) and verbal rating scale (VRS) pain scores compared to the use of lidocaine alone . Cryoanesthesia: Cryoanesthesia is a technique that involves applying extreme cold temperatures (-70°F to -180°F) to the skin to induce numbness and reduce pain through nerve receptor desensitization . This method is often used in dermatological procedures to numb the skin immediately before minor treatments or surgery. While research is exploring various modalities for use in cryoanesthesia, even a simple ice application has proven to be as effective as 20% benzocaine gel . In the past, mediums such as ethyl chloride and liquid nitrogen have been used to cause a transient drop in local skin temperatures. However, they were associated with adverse effects related to prolonged freezing, such as frostbite, dyspigmentation, and atrophic scarring . Cryoanesthesia with ethyl chloride was significantly more effective at alleviating pain compared to topical 5% lidocaine gel . CryoVIVE® is a newly introduced cryoanesthesia device that performs targeted cooling of the epidermis using CO2 gas. CryoVIVE® devices have thermo-sensor-enabled real-time temperature and duration monitoring to prevent the adverse effects associated with traditional forms of cryoanesthesia. CryoVIVE® was demonstrated to reduce pain by 40% without any observed adverse effects . Personalized anesthesia: Precision medicine is a personalized approach to healthcare that tailors medical treatments to each patient's specific needs and characteristics . By analyzing an individual’s genetic makeup, lifestyle, and environmental factors, healthcare providers can develop highly personalized treatment plans that optimize patient care. Genomic analysis uses genetic information to predict individual responses to different anesthetics and tailor treatment plans accordingly. Variations in genes can influence how patients respond to anesthesia. Proteomic analysis analyzes protein biomarkers to identify potential adverse reactions and allergies. Proper investigative studies can provide insight into the appropriate dosage and type of anesthesia needed for a particular patient and aid in predicting potential allergic reactions or adverse side effects. Comprehensive assessments of patient medical history and current medications can help identify individual risk factors and concerns regarding anesthetic choices. The ability to customize drug formulations for specific patient needs and skin types is an area of ongoing research. Aesthetic dermatology is a specialized field that focuses on improving the appearance and health of the skin with medical treatments. Pain management is an integral component of aesthetic dermatology that can affect patient satisfaction and clinical outcomes . The majority of aesthetic procedures performed, such as laser resurfacing, chemical peels, and injections, can be uncomfortable and even painful for some patients. Minimizing pain and anxiety during cosmetic procedures ensures patient comfort and accuracy during injections, as the patient is less likely to be restless or withdraw from the pain sensation. Although there are no statistically significant differences in pain scores among the most commonly used topical anesthetics in cosmetic and laser procedures (2.5% lidocaine/2.5% prilocaine cream (EMLA®), 4% tetracaine, or 4% liposomal lidocaine gel), most patients preferred 4% liposomal lidocaine gel . Although pain management is a critical component of dermatological procedures, there are still areas where research and development could improve patient outcomes and safety. Longitudinal studies are needed to explore the long-term consequences of different anesthetic modalities used in dermatologic practice. However, this may be challenging, given the rapid emergence of new technologies. Ongoing research should scrutinize and monitor the effects of new anesthesia drugs until more comprehensive studies can be realized. Research can identify proteins involved in anesthetic-induced neurotoxicity and develop strategies to mitigate these effects . The use of traditional anesthetics has been shown to induce neurotoxicity. Therefore, it is crucial to be aware of this complication and investigate the potential long-term effects of all developing anesthetic drugs used in patient populations . With the growing application of nanoparticles in drug delivery, there have been regulatory concerns about their long-term effects on the human body, which necessitates a pressing need to address the shortcomings in toxicology reports of nanoparticles . The small size of nanoparticles may enable access to various organ systems or translocation to unintended areas of the body, necessitating more research to understand the underlying mechanisms of drug targeting . Nanoparticles: As with everything else in medicine, the field of anesthesia in dermatology is constantly evolving. Emerging research explores pain management options that can improve patient comfort, safety, and outcomes during dermatologic procedures. New materials are continually being studied and tested as nanoparticle carriers for drug delivery. Nanostructured lipid carriers (NLC) are an emerging lipid nanoparticle that may offer advantages over other lipid-based carriers such as solid lipid nanoparticles and liposomes . Cubosomes are lipid-based nanoparticles with potential for active drug targeting via controlled release and ligand-receptor interactions . Recent in vitro, in vivo, and ex vivo animal studies demonstrated that lidocaine-loaded cubosomal gels significantly increased the penetrance of lidocaine into the skin and sustained its release, prolonging its anesthetic effects without any adverse effects . Virtual reality (VR): Distraction techniques may not eliminate pain, but they can help reduce pain perception by focusing patient attention elsewhere and employing different sensory modalities. Distraction techniques are already being used in pediatric settings, such as dental offices, through television or music in exam rooms. Unlike traditional distraction methods, VR is an immersive experience incorporating auditory, visual, and cognitive components. VR may help in pain management through distraction and non-distraction mechanisms by producing neurophysiologic changes related to conditioning and exposure therapies . A meta-analysis found that VR-based interventions may reduce needle-related pain, fear, and anxiety in children and adolescent populations . Further research should determine the variety of ways VR may provide an avenue to distract patients during dermatological procedures, reduce pain, and incorporate informational resources for patient education during procedures. More studies should examine the effect of VR-based interventions in larger patient populations and settings. Anesthesia plays a critical role in the success of dermatologic procedures, influencing the patient’s comfort as well as clinical and cosmetic outcomes. This review highlights the wide-ranging effects of different types of anesthesia, including topical, local, regional, and general anesthesia, on wound healing, infection rates, pain management, and the risk of complications such as allergic reactions and systemic toxicity. While local anesthesia remains the standard for most dermatologic interventions due to its efficacy and safety profile, special considerations must be taken when dealing with pediatric, geriatric, and high-risk patients. Despite the progress made in this field, further research is required to better understand the long-term impacts of anesthesia on wound healing and scarring, and to develop safer and more effective anesthetic agents for patients with comorbidities or those at higher risk for complications. Personalized anesthesia, informed by genetic and proteomic analysis, holds great potential to revolutionize patient care by tailoring anesthetic regimens to individual needs, thus optimizing outcomes.
|
Review
|
biomedical
|
en
| 0.999999
|
PMC11625188
|
Chronic pelvic pain in women is defined as persistent, non-menstrual pain located in the pelvis, lasting for more than six months . It is a significant social issue, estimated to affect up to 20% of women . Chronic pelvic pain accounts for approximately 40% of laparoscopies and 12% of hysterectomies performed annually in the United States, despite the fact that in 80% of cases, its etiology is not gynecologic . The etiopathogenesis of chronic pelvic pain is typically non-specific, as it is a multifactorial disorder. It is often linked to dysfunction of the female reproductive system, including conditions such as endometriosis, adenomyosis, uterine leiomyomas, ovarian cystic neoplasms, thecomas, fibromas, and ovarian fibrothecomas. Less commonly, it may be associated with disorders of the urinary, gastrointestinal, or pelvic nervous systems, all of which can significantly impact the quality of life . Ovarian thecomas, fibromas, and fibrothecomas are rare, non-cancerous sex cord/stromal tumors . Sex cord/stromal tumors account for less than 5% of all ovarian neoplasms . Thecomas are rare benign tumors of the ovarian stroma that can secrete estrogen, androgens, or a combination of both. They are estimated to represent less than 1% of all benign ovarian neoplasms and typically occur in premenopausal and postmenopausal women aged 50-60 years . The occurrence of thecomas in childhood and adolescence is exceedingly rare . Ovarian thecomas are usually unilateral, with tumor sizes ranging from 5 cm to 10 cm, and bilateral involvement in only 3% of cases . In extremely rare instances, ovarian thecomas have been reported during pregnancy . This paper presents the case of a 68-year-old woman diagnosed with a large ovarian thecoma, 25 years after undergoing a total abdominal hysterectomy with unilateral salpingo-oophorectomy. The case underscores the preoperative diagnostic challenges associated with this rare ovarian neoplasm. Additionally, it highlights the importance of regular pelvic examinations in women who have undergone total hysterectomy with ovarian preservation, irrespective of the presence or absence of pelvic symptoms such as chronic pelvic pain. A 68-year-old patient, with a history of two vaginal deliveries and an abdominal total hysterectomy with right salpingo-oophorectomy performed 25 years ago due to uterine leiomyomas and menometrorrhagia, was referred from the gastroenterology department to the gynecology department for further investigation of chronic pelvic pain. The onset of the pain dated back approximately 18 months and was described as mild, deep, constant, and occurring daily. A colonoscopy revealed no abnormal findings and clinical and imaging examinations of the urinary tract showed no lesions affecting the kidneys, ureters, or bladder. The patient's medical history included well-controlled arterial hypertension and hypothyroidism. Her family history was unremarkable. The etiopathogenetic mechanisms of sex cord/stromal ovarian neoplasms have not yet been fully elucidated. Sex cord/stromal ovarian tumors are rare ovarian neoplasms that include various tumor subtypes with diverse histological features and biological behaviors . Ovarian thecomas are classified as a subtype of stromal tumors according to the World Health Organization classification, revised in 2014 . Ovarian thecomas consist of stromal cells containing lipids (theca cells), which surround ovarian follicles and typically exhibit estrogenic activity . Additionally, genetic syndromes such as Peutz-Jeghers syndrome and DICER1 syndrome are thought to be associated with the pathogenesis of ovarian thecomas . The clinical manifestations of ovarian thecomas are non-specific, making preoperative diagnosis challenging . Most patients with ovarian thecoma are asymptomatic, particularly when the tumors are small in size . Symptoms such as abdominal distention, vague abdominal discomfort, and chronic pelvic pain, as seen in our patient, are typically associated with larger thecomas . In addition, ovarian thecomas frequently cause endocrine disorders due to hormone secretion. The secretion of androgenic hormones can result in oligomenorrhea and the gradual development of secondary male characteristics in women, such as excessive hair growth, facial acne, and clitoral hypertrophy . Rarely, in postmenopausal women, ovarian thecomas can cause endometrial hypertrophy and vaginal bleeding, making it imperative to differentiate them from uterine malignancies . In very rare, isolated cases, ovarian thecoma may also be associated with Meigs syndrome . The presence of ascites is typically linked to larger tumors, regardless of cancer antigen 125 (CA-125) levels in the blood serum . Additionally, in extremely rare instances, thecomas may occur during pregnancy, with the first clinical manifestation being acute abdominal pain caused by pedicle torsion . In our patient, the diagnosis of ovarian thecoma was delayed. The patient’s history of hysterectomy likely hindered regular gynecological screenings, resulting in a missed diagnosis during the asymptomatic phase. The patient presented for examination at the gynecological clinic when the ovarian thecoma had reached a larger size, causing chronic pelvic pain due to increased pelvic pressure. The use of modern imaging modalities plays a crucial role in the preoperative diagnosis of ovarian thecomas. Transvaginal ultrasound and Doppler ultrasound imaging of the ovaries are first-line imaging examinations. The typical sonographic features of ovarian thecomas include hypoechoic solid masses with well-defined borders and the presence of striated shadows, with minimal flow signals on Doppler ultrasonography . MRI is a highly useful diagnostic tool for the female reproductive system and is thought to significantly improve the accuracy of preoperative diagnosis of ovarian thecomas . In 2024, Zheng et al. highlighted the utility of MRI in the differential diagnosis of benign thecomas/fibromas from solid malignant ovarian neoplasms in their study . Although CT cannot replace the importance of evaluating ovarian tumors with MRI, it can still be a useful tool for diagnosing ovarian thecomas/fibromas. The compact consistency of the tumor, its unilateral location, and the absence of enlarged lymph nodes or peritoneal metastases are characteristic CT findings that aid in the early diagnosis of ovarian thecoma/fibroma. These findings help reduce unnecessary referrals of patients to tertiary oncology centers, alleviating the stress that can arise from misdiagnosis of ovarian malignancy . In our patient, the imaging results indicated the benign nature of the pelvic mass, which influenced our decision to proceed with laparotomy at our hospital rather than referring the patient to a tertiary gynecological oncology center. This approach spared the patient unnecessary stress and also helped avoid additional hospitalization costs. Surgery remains the cornerstone in the treatment of ovarian thecomas. A conservative approach (tumor resection or unilateral salpingo-oophorectomy) is preferred in young women, where fertility preservation for future pregnancy is a primary goal. In older patients, more radical procedures, such as bilateral salpingo-oophorectomy with or without hysterectomy, depending on the patient’s overall condition, are generally the recommended treatment options . In our patient, the only viable treatment was the surgical removal of the thecoma along with the corresponding ovary and fallopian tube. Of course, confirmation of the diagnosis of ovarian thecoma requires a histological examination of the surgical specimen. Histologically, thecomas are characterized by spindle-shaped, oval, or round cells with varying amounts of collagen and a smaller proportion of theca cells . Additionally, microscopic pathological findings such as hyaline plaques, nodular growth, calcification, and keloid-like sclerosis are often observed in these neoplasms. In about 40% of cases, features of fibroma are also present. Although degenerative atypia is rarely seen, it is essential to differentiate ovarian thecomas from other stromal ovarian tumors, such as sclerosing stromal tumors, microcystic stromal tumors, steroid cell tumors, and adult-type granulosa cell tumors of the ovary . The prognosis of ovarian thecomas is generally favorable .
|
Review
|
biomedical
|
en
| 0.999996
|
PMC3194545
|
We report on a 20-years-old girl, affected since one year of age, by a severe form of poliarticular JIA. She received immunosuppressors (Metrotrexate, Azathioprine…) associated with steroids, with no articular benefit. When Enbrel plus Metrotrexate was started, she got into remission. After one year she presented uveitis bilaterally, so steroids were started again. She obtained partial ocular improvement, receiving Infliximab plus Metrotrexate, but the former was suspended because of an adverse reaction (dyspnea, rash) and Adalimumab was started, with no side effects. After three years, she had flare for uveitis and arthritis. Adalimumab was suspended and Abatacept was started, with no side effects. After 12 months, uveitis seems to be stable, while arthritis, after a good initial response, seems to be active again.
|
Review
|
biomedical
|
en
| 0.999996
|
PMC3844940
|
A 30-year-old female patient presented with a history of three months complaining of interscapular chest pain and progressive dyspnea on exertion. Last two weeks she had nocturnal dyspnea and excessive chest pain. The patient had no clinical signs of myasthenia gravis. Radiological investigations revealed a mass lesion of 82x55x90 mm located in the anterior mediastinum without any calcifications or mediastinal extension. Echocardiography showed compression of the right ventricle with dilatation of the inferior vena cava. The patient was operated on standard median sternotomy. During the operation, a well encapsulated large tumor tissue was observed. Macroscopically it was suggestive of thymoma with large areas of necrosis and caseous tissues. No infiltration of the pleura or pericardium was observed. The tumor was completely removed. The postoperative course was free of complications, except an inflammatory syndrome with subfebrile temperature ranging 37,5 to 38,0 for a period of 5 days. Histopathological examination confirmed the diagnosis of a type A thymoma with large areas of necrotic tissues and cystic degeneration. At control after four years no signs of recurrence of the disease are noted on computed tomography.
|
Other
|
biomedical
|
en
| 0.999996
|
PMC8576853
|
The inclination of the roots, from the point of their cervical emergence, causes the experimental pure forces of intrusion at angles perpendicular to the occlusal surface of the molars, to exert inclination forces on their roots. Even if the professional exerts apparently intrusive forces, they indeed are not, due to the inclination of the teeth and their roots - that is, there are no pure intrusion forces in tooth movement. In experimental studies, 3 - 6 resorptions have been microscopically observed in the apical region and in the root surfaces facing the bifurcations. The intrusive effect of inclination forces during the mechanics known as intrusive can, in part, be explained by regional orthopedic stimulus to reshaping, represented by the forces on the bone, at the expense of the periosteal and endosteal tissues. 1 The periosteum reacts to stimuli or aggressions of low intensity and long duration with the formation of new bone layers on the cortical surfaces; that is, at the periosteum-cortical interface. 1 , 7 , 8 This reaction capacity can modify the shape of the bone in question, by increasing its volume or thickness. The endosteal and periosteal surfaces of the bone are compensated by the cellular information transferred from the periodontium to the periosteum by the osteocyte network controlling the bone design. 1 , 7 , 8 Force-induced bone deformation, or deflection, modifies the final maxillary shape, as remodeling allows the tissue to meet the new functional demands transmitted to the entire bone via the osteocyte network 1 . Subperiosteal cortical resorptions and appositions can occur on the external part of alveolar processes, where the teeth are being intruded , which can also occur on internal surfaces, such as the walls of the maxillary sinus and of the nasal cavity. This same phenomenon on endosteal surfaces changes and rearranges the bony trabeculae, both in terms of their spatial distribution and the thickness and length of the bony trabeculae. 1 The high risk of root resorption 3 is always mentioned when it comes to intrusion movements, which are mentioned when referring to intrusive mechanics - intrusive mechanics does not mean intrusion force, as we explained before. There are many studies that have revealed that there is no such relationship between tooth resorption and intrusion force 5 , 9 - 13 The forces that become most concentrated and potentiated in points of the periodontal ligament, with death of cementoblasts, are those of inclination, which characterize the intrusive mechanics. 7 The use of specific appliances, with absolute anchorage by means of plates and osseointegrated implants in dogs’ teeth, 3 induced imagiologically insignificant root resorption, despite the intrusive effects obtained. The same occurred microscopically after a period lasting between four to seven months. 4 , 5 , 6 Clinical trials with important intrusive effects have also revealed a very low or non-existent rate of tooth resorption. 14 , 15 Appliances with absolute anchorage tend to distribute more homogeneously the forces that are applied, dissipating and eliminating the points of concentration of forces in periodontal tissues. This reduces the possibility of death of cementoblasts along the root, and reduces the chance of root resorptions. 16 In Apolinário’s study, 17 intrusion of posterior teeth, necessary for the correction of the anterior open bite, was distributed among the four hemiarches, with the aid of four miniplates used as anchorage. The sample consisted of 40 DICOM files (20 before and 20 after) from cone beam computed tomography scans requested for 3D evaluation before and after orthodontic treatments performed with the aid of miniplates, between the years of 2014 and 2018. The patients were of both genders, aged between 18 to 59 years, with anterior open bite, with overbite of up to -7.6 mm, orthodontically treated with maxillary and mandibular posterior intrusion, anchored on four miniplates; whose tomographs had a FOV (field of view) greater than or equal to 23 x 17 cm. In all cases, intrusion of maxillary and mandibular posterior teeth was obtained. The distances from the cementoenamel junction in relation to the axial plane were measured in the central incisors, maxillary first and second molars; and so were the distances between the apex of the incisors and the mesial root of the maxillary first and second molars to the axial plane, in the pre- and post-treatment phases. In the mandibular teeth, the distances from the cementoenamel junction to the mandibular plane were measured in the central incisors and mandibular first and second molars; and so were the distances between the mandibular plane and the apex of the incisors and the mesial root of the mandibular first and second molars, in the pre- and post-treatment phases. The values of the measurements before and after the intrusion were found to be statistically significant for the maxillary first molars on the right and left sides in relation to the axial plane, and for the mandibular first and second molars on the right and left sides in relation to the mandibular plane. In this study, it could be concluded that the amount of dental intrusion obtained in both arches was similar to the values found in the literature; however, with the use of four posterior miniplates, the intrusion was enhanced in both the maxillary and mandibular arches, when compared with the intrusion performed in a single arch. The use of miniplates to obtain the intrusion of teeth into the jaws bones was carried out without root resorption or, when root resorptions were identified in the images, they were so small that their extension was questionable. The natural inclination of the roots favors the tooth movements in intrusive mechanics to be of inclination type. There are compression forces in some areas of the periodontal ligament, with deformation or deflection of the osteocyte network that controls bone design. In other areas, there is deformation of the osteocyte network, due to tension forces. These effects involve the external and internal surfaces of the bone in the alveolar process, with the formation of new layers and areas of resorption, including the cervical portion of the alveolar bone crest. In intrusive mechanics with the use of miniplates, alveolar remodeling of an orthodontic nature occurs, associated with modification of the internal and external bone structure, to meet the demands of forces with orthopedic nature. 1 The intrusive effect in so-called intrusive mechanics may be the result of alveolar remodeling induced by inclination forces and changes in bone volume resulting from subperiosteal bone formation in the external part of the alveolar process 1 , 5 , 8 The more homogeneous distribution of forces with absolute anchorage on miniplates explains the insignificant level of root resorption. 16
|
Other
|
biomedical
|
en
| 0.999997
|
PMC8799400
|
Neurofibromas are the most common benign peripheral nerve tumors infrequently present in patients with the autosomal dominant syndrome neurofibromatosis type 1 (NF1). NF1 affects roughly 1 in 3500 newborns and is considered one of the most commonly occurring genetic diseases . Plexiform neurofibromas represent a rare variant (30%) of NF1 in which the nerve fibers thicken due to the spread of tumor cells along nerve fascicles . Distinguishing features comprise Lisch nodules (iris hamartomas), pigmented skin lesions (e.g. cafe-au-lait spots), organ or tissue damage (visceral, skeletal, and neural), and malignant or benign tumors. A mutation on chromosome 17q11.2 causes NF1 by affecting the synthesis of neurofibromin (a tumor suppressor protein), which is expressed at high levels in the nervous system in unaffected individuals. Conversely, a low level of neurofibromin is associated with developing benign and malignant tumors, mainly of the nervous system, such as malignant peripheral nerve sheath tumors (MPNST), gliomas, and schwannomas . A 14-year-old Malay male known case of NF1 presented with a four-month history of pain and swelling on the medial side of the right knee, and a limping gait, preceded by a history of fall. Local examination showed an 8x5 cm ill-defined mass over the medial aspect of the right knee, which was hard and tender with restriction of knee joint movement. Radiographs of the right knee revealed an ill-defined lytic lesion at the proximal third of the right tibia with periosteum elevation . MRI of the right knee revealed an irregular lobulated enhancing mass measuring 4.2x4.4x6.9 cm involving the proximal metadiaphysis of the right tibia. The chest CT scan was normal. A bone scan revealed no evidence of skeletal metastasis. NF1 is an autosomal dominant disorder that decreases the synthesis or function of neurofibromin (tumor suppressor protein production), increasing the risk of benign and malignant soft tissue tumors . One of the rare neurofibroma variants is plexiform neurofibromas, in which the spread of tumor cells along nerve fascicles leads to a diffuse mass of thickened nerve fibers, involving connective tissue and skin folds that appear as bags of worms. In about 10% of cases, these lesions progress to MPNST . NF1 is more susceptible to developing benign and malignant neoplasms, mainly of neurogenic or neuroendocrine origin. When compared to the general population, people with NF1 have a four- to six-fold increase in the risk of developing a malignancy (24%), according to Zöller et al. and recent research studies . In addition, unusual tumors are more frequent in patients with NF1, such as pheochromocytoma, carcinoid tumor, chronic myeloid leukemia, brain tumors, and MPNST. Compared to the common tumors such as lung, breast, colon, kidney, and prostate cancer, all of which can occur, but their occurrence is less than in the normal population . Most of the NF1 malignant transformations are progressed to MPNST, but fewer cases may be accompanying heterologous differentiation components. Common heterologous components are chondrosarcoma, rhabdomyosarcoma, angiosarcoma, and osteosarcoma . The different localizations of leiomyosarcomas reported in NF1 patients were intracranial, liver, hand, sciatic nerve, pelvis, and bladder . Afşar et al. summarized NF1 patients developing rare tumors from 1989 until 2013. The results generated by the literature search summarized the clinical characteristics of 43 patients with NF1 and somatostatinoma, eight patients with osteosarcoma, and 15 patients with leiomyosarcomas, which were found at different locations, including the sciatic nerve, liver, bladder, and intestine . Compared to Zöller et al. , they reported only two cases of leiomyosarcoma amongst 70 patients with NF1. A recent study conducted in 2020 by Landry et al. on 1607 patients with NF1 found 666 (41.4%) patients who developed other neoplasms in addition to neurofibromas. Among the patients in the study group, 285 (17.7%) developed sarcomas, and only two (0.1%) developed leiomyosarcoma. This different localization illustrates the need to be aware of potential leiomyosarcoma in NF1. Many studies report and prove that wide local excisions of the mass, followed by radiation therapy, are the most accepted treatment method . This case can be added to the few reported cases in the literature describing leiomyosarcomas in patients with NF1. It raises the voice that examining the patients routinely and considering leiomyosarcoma in the differential diagnosis is crucial to getting a better outcome. It highlights that physicians should be perceptive that there is a possibility of malignant tumors in NF1 patients and their histological characteristics and prognosis. Understanding the different presentations and the early establishment of an accurate diagnosis can be advantageous in commencing timely management and reducing morbidity and mortality.
|
Study
|
biomedical
|
en
| 0.999997
|
PMC9014884
|
The retrorectal or presacral space is bounded anteriorly by the rectum, posteriorly by the sacrum, superiorly by the peritoneal reflection, inferiorly by the pelvic diaphragm muscles (levator ani and coccygeus), and laterally by the ureters and iliac arteries and veins . Tailgut cysts or retrorectal cystic hamartomas present in the retrorectal space, an area with complex embryology and anatomy, which offers the potential for a wide variety of benign and malignant pathology . Tailgut cysts are rare congenital malformations that are embryologic remnants of the postnatal component of the hindgut . As the embryo folds during the fourth week of gestation, the cloacal membrane progresses ventrally and encloses a portion of the future gut that is distal to the eventual hindgut - a region known as the “tailgut” . Typically, the tailgut involutes around the sixth week of gestation; however, when this process fails, a tailgut cyst remains . Tailgut cysts are quite rare, but the true incidence has been difficult to quantify as the majority are asymptomatic and can easily be missed on the digital rectal exam . Most patients present between the ages of 30 and 60 years, and there is a strong female predominance, likely occurring three to five times as often in women as in men . When tailgut cysts do cause symptoms, these are normally due to the mass effect of the lesion on adjacent organs, cyst infection, or malignant transformation . Mass effect can lead to such symptoms as constipation, tenesmus, dyschezia, and/or polyuria; and lesion infection may manifest as a perianal fistula or a pelvic abscess . Based on recent studies, the overall rate of malignant transformation of tailgut cysts is estimated to be as high as 26% . A 46-year-old woman with an uneventful past medical and surgical history was evaluated for lower back pain. Her diagnostic workup included an MRI of the lumbar spine and sacrum. This imaging study demonstrated an extremely low-lying (caudal), multi-loculated retrorectal lesion 3.7 cm in its greatest dimension, most likely representing a tailgut cyst (cystic hamartoma) . After being informed about the lesion on her imaging study, the patient relayed that she occasionally felt pain around her tailbone (coccyx) when sitting. Digital rectal examination immediately demonstrated the presence of a caudal, tender, soft, non-mobile retrorectal mass. The examining finger was able to pass superiorly to the mass and palpate a normal mid-S5 sacral vertebra. Perianal examination revealed a normal resting tone, normal squeeze, and no perineal descent or prolapse with Valsalva; furthermore, there was no gross perianal pathology. Aside from these findings, the remainder of the physical exam was unremarkable. Laboratory studies were within normal limits, and there was no radiographic evidence of extra-pelvic disease. The patient underwent complete resection of the mass through a posterior (Kraske) approach. An incision was made extending 6 cm from the coccyx superiorly. Sharp dissection was used to carry the incision down directly in the midline until the presacral fascia was encountered. The medial gluteal fibers were then divided bilaterally to expose the distal sacrum and attached mass. The mass had multiple tense and cystic loculations, one of which was inadvertently entered, releasing a thick, non-malodorous, purulent fluid consistent with sterile pus. The lesion was resected en bloc with its fibrous attachments to the distal coccyx and inferior S5 sacral vertebra by dividing across the mid S5 sacral vertebra. After the removal of the mass, orthopedic files and a rongeur were used to dull the sharp edge of the sacral transection, and bone wax was placed to prevent additional bleeding or soft tissue injury. The gluteal muscles were returned to the midline, and a Jackson-Pratt drain was cut to size and passed into the presacral space through a separate, lateral skin site. The remaining layers of the incision were re-approximated and closed. The patient tolerated the operation without any complications, and her postoperative course was uneventful. The patient returned to the clinic two weeks later for the removal of the drain and skin sutures and achieved a complete functional recovery soon thereafter. Imaging, namely MRI and CT scans, is the principal method by which retrorectal masses can be diagnosed . Other imaging modalities can be useful but are not diagnostic . On MRI, tailgut cysts may demonstrate hypointensity on T1-weighted images and hyperintensity on T2-weighted images (although, this is not always the case, as cyst contents can vary) . Fine-needle aspiration has been demonstrated to be successful but is not considered standard due to the potential risks, and current consensus calls for surgical resection of the diagnosed mass with subsequent gross pathological and histopathological evaluation . Surgical resection is recommended for both asymptomatic lesions (due to risks including malignant transformation) and symptomatic tailgut cysts . Approaches may vary widely, from laparoscopic to transabdominal to transsacral to transanal, and each approach offers a unique set of potential benefits and drawbacks . Low-lying (caudal) retrorectal masses (entirely below S3) can safely be accessed via a posterior, or Kraske, approach, avoiding entry into the peritoneal cavity; however, this approach is generally not recommended for more cranially located lesions . These higher lesions (entirely above S3) can be excised via an anterior, or abdominal, approach . When lesions lie both above and below the level of S3, an integrated abdominosacral approach may be warranted . When the posterior approach is employed, a coccygectomy may be performed for better surgical exposure . If the tailgut cyst is not resected entirely, there is a possibility for recurrence . Many treatment options have been explored, but en bloc resection with clear margins is the most effective one and is associated with decreased incidence of recurrence and improved patient outcomes . Following excision, an annual digital rectal exam is recommended; furthermore, a CT scan is recommended in postoperative years one and five .
|
Study
|
biomedical
|
en
| 0.999996
|
PMC9083879
|
Fibrous hamartoma of infancy (FHI) is a benign soft tissue lesion recognized by its triphasic morphology since the early days. 1 It is frequently known to have its onset during the first two years of life; subsequently, several reports indicated deviation from its classic demographics with expanded age range and anatomic distribution outside its classic locations. 2 - 4 While the natural course is classically benign with an excellent prognosis, the histogenesis of this tumor is still elusive, with the lesion being described as neoplastic, to being hamartomatous or a malformation. 5 Nevertheless, the favorable prognosis is often marred by local recurrences with rare sarcomatous transformation on record. 6 We describe one such example of FHI as a congenital mass in a three-month-old infant with distinctive morphology albeit with sarcomatous transformation and discuss the differentials. Such lesions should be correctly diagnosed as local recurrences are known to occur. A 3-month-old boy presented with a mass in the lower back, which was present since birth. It initially measured 3x2 cm with a tuft of hair and gradually increased in size. There was no associated bowel or bladder disturbance, no paucity in lower limb movements, or any discharge history from the swelling. On examination, the mass measured 10x15 cm and was soft in consistency, non-tender, non-fluctuant. It extended from L1 to the right gluteal region. Anthropometric parameters were normal for his age. Investigations revealed normal hemogram and normal biochemical parameters, including alpha-fetoprotein levels (85.9 IU/ml; reference range 5-877 IU/ml). The magnetic resonance imaging (MRI) of the lumbosacral spine revealed large subcutaneous mass in the lumbosacral region on the left side measuring 6.5 x 3.7 x 5.6 cm along with intensely enhancing solid component and multiloculated cystic areas. In addition, a bifid spinous process of L4-L5, S1 was noted. The clinical possibilities considered included lipoma, lymphangioma, meningocele, rhabdomyosarcoma, or sacrococcygeal teratoma. The lesion was excised. No capsule could be identified peroperatively. On gross examination, the lesion contained both solid and cystic areas and measured 9x5x3 cm. On microscopy, a poorly circumscribed tumor was identified, which revealed immature mesenchymal cells arranged in long fascicles and trabeculae intercepted by fibrocollagenous tissue composed of bland fibroblasts and myofibroblasts. The tumor also showed lobules of mature adipocytic tissue . Few dilated blood vessels, some with stag-horn morphology were observed, more at the periphery of the lesion . The immature mesenchyme was characterized by round to elongated cells with vesicular chromatin, inconspicuous nucleoli and moderate amount of eosinophilic cytoplasm . The immature mesenchyme demonstrated immunopositivity for vimentin. Smooth muscle actin (SMA) highlighted the fibroblasts and myofibroblasts amidst the neoplastic component. CD99 showed diffuse strong perinuclear dot-like positivity. Cytokeratin, myogenin, melan A, desmin, and HMB45 were negative. S-100 highlighted the adipocytes. CD34 highlighted the blood vessels while was negative in all other three components . The tumor was also evaluated for ETV6-NTRK3 fusion and was found to be negative. Such triphasic morphology favored FHI, albeit with sarcomatous transformation. A rare and unique tumor in infants, FHI commonly arises in axillary regions, upper arms, upper trunk, inguinal region, and external genital areas. Nearly 25% may occur congenitally. 7 as was seen in the index case. They are commonly confined within the subcutaneous plane and range from 0.5-4cm in diameter. The clinical and radiologic features of this entity are nonspecific, and hence can be confused with malignant soft tissue tumors. 8 , 9 The histogenesis is still unclear with the lesion being referred to as malformation to hamartomatous to a neoplastic one. On histology, it typically shows a triphasic morphology with a variable admixture of primitive mesenchyme, fascicles of fibroblasts/myofibroblasts and adipose tissue. While histology alone is sufficient for diagnosis, immunohistochemistry is a useful adjunct. Electron microscopic and immunohistochemical studies have demonstrated that the two mature components within the lesion comprise fibrous and adipose tissue, while the immature mesenchymal component has primitive fibroblastic features, and lacks muscle or neural differentiation. 10 In the index case, the mesenchymal component contained sarcomatous-appearing foci with high cellularity, high nuclear grade, and brisk mitotic activity. The occurrence of such high-grade areas is rare and documented in only two cases in a large multi-institutional cases series comprising 145 cases of FHI. 6 Amongst the two reported cases in their series, one arose in a 6-year-old boy while the other was a congenital lesion. The clinical significance of such morphology remains to be determined as the follow-up was lacking in one of their cases, while the patient with a congenital tumor was treated with radical resection and was reported to be well four years following surgery. A few uncommon cases with large size, rapid growth, infiltrative growth, and/or locally recurrent have also been reported. 11 , 12 Nevertheless, identifying sarcomatous-appearing foci is essential as local recurrence happens in such masses. 6 The common diagnostic differentials depend on age and the anatomic site. Fibromatosis, lipofibromatosis, rhabdomyosarcoma, teratoma, and congenital fibrosarcoma are differentials for a tumor arising at this location. 13 Fibromatosis in infants and children occur exclusively in fingers and toes and microscopically, reveals fascicles of spindle cells set against a variably collagenized stroma with infiltrating borders. Lipofibromatosis is characterized by abundant adipose tissue traversed by bundles of fibroblast-like cells and is devoid of any immature mesenchymal component. Rhabdomyosarcoma, the classic ‘small-blue, round cell’ tumor, features sheets of primitive-looking, small round cells with high N/C ratio, which are positive for desmin, myoD1, and myogenic, which were negative in the present case. Teratomas are known to have a variable morphology depending upon the component of the germ layer constituting its bulk. Although rare at this location, congenital fibrosarcoma, a malignant spindle cell tumor, also needs exclusion. They are composed of small, spindle-shaped cells separated by variable amounts of pale stroma, often myxoid in appearance. ETV6-NTRK3 gene fusion reliably differentiates this tumor from other childhood spindle-cell tumors. 14
|
Clinical case
|
biomedical
|
en
| 0.999996
|
PMC9097177
|
While bone marrow in the fetus is entirely hematopoietic, conversion to fatty marrow begins in the distal extremities soon after birth and is confined to the axial skeleton, proximal humeri, femoral neck, and intertrochanteric regions by young adulthood. The hematopoietic marrow itself is composed of cellular components and varying amounts of fat, whereby the fat content increases with age . Mild forms of hyperplasia of the red bone marrow are associated with heavy smoking, long-distance running, and obesity [ 2 – 4 ]. More severe and diffuse forms can be related to chronic anemias (particularly hematolytic types) and benign and malignant infiltrative bone marrow disorders, such as Gaucher disease, myelofibrosis, myeloma, and lymphoma, leukemia, and metastatic disease . Besides, hematopoietic marrow hyperplasia can be encountered after administering granulocyte-colony-stimulating factors . Since peripheral manifestations of hematopoietic bone marrow hyperplasia are significantly more common than those of the axial skeleton, these foci are often accidentally seen on routine MRI of the lower extremities, in particular around the knee joint, as previously described in a case series of Deutsch et al. . However, focal hyperplasia of the red bone marrow has been found within the axial skeleton, described in a case report by Bordalo-Rodrigues et al. in 2002 . Other examples given, two previous case reports described the detection of focal hematopoietic hyperplasia in the ribs . This retrospective single-center analysis included ten patients with 14 hematopoietic islands of the axial skeleton who underwent both MRI and CT at the initial diagnosis between January 2006 and January 2020. Patients’ characteristics are summarized in Table 1 . In detail, patients were retrospectively identified via a full-text query within the local radiology information system using the search term “hematopoietic island.” Subsequently, the resulting reports were further filtered concerning the availability of initial MRI and CT examinations and the presence of sufficiently long follow-up periods (at least six months) and/or histologically confirmed lesions. None of the tumor patients included had apparent osseous metastases. In two patients, long-term follow-up of 28 respectively 50 months was available despite the histopathological findings derived from CT-guided biopsy. Table 1 Patients’ characteristics Patient Age Sex Lesion localisation [n] Lesion size a Previous malignancy Primary CT-guided biopsy MRI follow-up [months] 1 66 f Thoracic spine Lumbar spine 0,8 × 0,6 1,0 × 1,0 1,6 × 1,2 1,6 × 1,6 Breast cancer yes 28 b 2 67 f Os sacrum 1,3 × 1,1 Gastric SRCC no 96 3 64 f Os sacrum 1,1 × 1,2 Breast cancer yes 4 65 f Os sacrum 1,6 × 1,7 no yes 5 53 f Rib 1,8 × 0,8 no yes 50 b 6 50 f Lumbar spine 1,5 × 1,3 Breast cancer (IDC) no 29 7 73 f Lumbar spine 1,0 × 0,9 no no 20 8 72 f Thoracic spine 1,3 × 1,2 no no 6 9 49 m Lumbar spine Os ilium 1,0 × 1,0 1,2 × 1,3 no yes 10 74 f Lumbar spine 2,1 × 1,8 no no 11 Total [n] 10 Mean [years] 63.3 (49–74) Median [years] 65.5 Male/ female ratio [n] 1/9 Total [n] 14 Mean [cm 2 ] 1.72 (0.48–3.78) Median [cm 2 ] 1.46 Total [n] 4 Total [n] 5 Mean [months] 34.2 (6–96) Median [months] 28 f Female, m Male, SRCC Signet ring cell carcinoma, IDC Invasive ductal carcinoma a lesion size [cm x cm, axial T2- weighted images] b additional MRI follow-up in patients who underwent CT-guided biopsy MR imaging was performed using a 1.5 Tesla unit (Avanto, Siemens Healthineers, Erlangen, Germany). MRI spine protocols routinely comprised the following pulse sequences: Sagittal T1-weighted turbo spin-echo (TSE) MR imaging (repetition time msec/ echo time msec: 400–700/ 8–16), sagittal T2-weighted TSE MR imaging , sagittal short tau inversion recovery (STIR) TSE MR imaging , and contrast-enhanced T1-weighted TSE MR imaging (repetition time msec/ echo time msec: 500–600/ 9–13). The slice thickness for standard morphological sequences varied between 3 and 4 mm. The field of view and matrix varied as being adapted to the individual distribution of the lesions. In three patients (patients 1, 8, and 10; Table 1 ), diffusion-weighted imaging using reversed fast imaging with steady-state free precession sequence (SSFP) was done (repetition time msec/ echo time msec: 25/ 7.17; slice thickness mm: 7). In two patients (patients 1 and 10; Table 1 ), sagittal in-phase (100–165/4.2; flip angle, 30°) and out-of-phase (100–165/2.1; flip angle, 30°) fast multiplanar spoiled gradient-echo chemical shift imaging was performed. All patients underwent high-resolution CT at least once at the initial diagnosis. In addition, two of the patients (patients 1 and 2; Table 1 ) received 18 F- fluorodeoxyglucose (FDG) PET/CT, and one (patient 1; Table 1 ) Technetium (Tc) 99 m skeletal scintigraphy. The location and size (maximum diameter on axial T2-weighted images), as well as the signal intensities on all morphological MRI sequences, were evaluated, as well as bone texture changes (osteosclerosis/-lysis) on CT respectively FDG-uptake on PET/CT in two cases, and radiotracer accumulation on skeletal scintigraphy in one case. In addition, signal behavior on DWI and CSI was analyzed according to the known methods . Using SSFP sequences, the signal intensity of each lesion was assessed qualitatively in relation to the adjacent bone marrow as either hypo-, iso- or hyperintense. According to Zajick et al., decreases in signal intensity greater than 20% on out-of-phase images compared with in-phase images have been used as a cut-off threshold for normalcy to allow distinction between benign (> 20% signal decrease on out-of-phase images) and malignant (< 20% signal decrease on out-of-phase images) marrow changes on CSI . A total of 14 lesions in ten patients were analyzed. One patient showed four lesions, one patient showed two lesions respectively, while all other patients presented with one single lesion. The lesions were located at the thoracic spine ( n = 4), lumbar spine ( n = 5), Os sacrum ( n = 3), Os ilium ( n = 1), and the rib ( n = 1). Lesion size ranged from 0.48–3.78 cm 2 (mean: 1.72 cm 2 ). All lesions had fairly sharp margins and were well demarcated from adjacent bone marrow. Detailed information on lesions’ localization and size is provided in Table 1 . Without exception, all lesions presented with moderate hypointense signals on T1- and T2-weighted images ( n = 14) while being isointense ( n = 5) to slightly hyperintense on STIR-sequences ( n = 9) . After gadolinium administration, all lesions ( n = 13) showed mild enhancement . In n = 3 patients DWI with SSFP sequences was performed, where all lesions presented hypointensity compared to adjacent normal bone marrow . On CSI ( n = 2), lesions showed a signal drop of greater than 20% on out-of-phase images compared with in-phase images, indicating fat within the lesions. Fig. 1 64-year-old woman with a history of breast cancer and focal hyperplasia of hematopoietic marrow in the massa lateralis of the sacrum. Arrows point to the lesion; H&E, hematoxylin and eosin. a Coronal T1-weighted TSE MR image of the sacral spine shows a focal area of moderately decreased signal intensity in the left massa lateralis. b Axial T2-weighted TSE image with a focal signal drop in the left massa lateralis (corresponding to a). c Slight hyperintense signal of the lesion is shown on the coronal STIR image. d On the axial contrast-enhanced fat-saturated T1-weighted image, the lesion shows slight enhancement. e High-resolution CT scan without any bone structure abnormalities (note: prone position before CT-guided biopsy). f Photograph of biopsy specimen (H&E, × 80) of the lesion shows hypercellular bone marrow with a reduced number of adipocytes. No neoplastic cells were found Fig. 2 66-year-old woman with a history of breast cancer and presence of focal hyperplasia of hematopoietic marrow in the thoracic (Th10, Th11, Th12) and lumbar spine (L1). Images illustrate the Th12 and the L1 lesion (arrows); SSFP, steady-state free precession; H&E, hematoxylin and eosin. a Sagittal T1-weighted TSE MR image of the thoracic and lumbar spine shows focal areas of moderately decreased signal intensity in the vertebral bodies of Th12 and L1. b Sagittal T2-weighted TSE image with a signal drop in Th12 and L1 (corresponding to a). c Sagittal STIR image with slightly hyperintense signal in Th12 and L1 lesions. d Lesions show slight focal enhancement after gadolinium administration on a sagittal T1-weighted image. e Sagittal SSFP image with a hypointense signal of the Th12 and L1 lesion. f High-resolution CT scan without bone structure abnormalities in Th12 and L1. g Photograph of biopsy specimen (H&E, × 80) of the Th12 lesion shows hypercellular bone marrow with a reduced portion of adipocytes In summary, typical MRI and CT findings of hematopoietic islands in contrast to osteoblastic metastases are presented in Table 2 . Table 2 Characteristic imaging findings of hematopoietic islands and osteoblastic metastases Imaging Hematopoietic islands Osteoblastic metastases T1w Slightly hypointense Markedly hypointense T2w Slightly hypointense Markedly hypointense STIR Iso- slightly hyperintense Iso- hypointense ce T1w Slight enhancement No/slight enhancement CT No sclerotic or lytic bone changes Sclerosis w Weighted, STIR short tau inversion recovery, ce Contrast-enhanced (gadolinium) Normal bone marrow shows intermediate signal intensity on T1-weighted spin-echo images since it contains about 50% fat and 50% water in adults . In our patient cohort, all hematopoietic islands presented moderate hypointense signals on unenhanced T1-weighted TSE images compared to surrounding bone marrow. This is explained by the fact that a significant amount of fat is still preserved in hematopoietic islands. Our finding is consistent with previously reported cases of focal hematopoietic islands [ 2 , 9 – 11 ]. All lesions described in the literature also presented mild hypointense signals on T1-weighted images, which helps differentiate these lesions from osteoblastic metastases, which usually show substantial T1 signal drop isointense or even hypointense compared to adjacent muscle or disk . Unenhanced T1-weighted sequences are essential in differentiating benign lesions with fat content (like benign bone marrow lesions or edema) from metastases, which generally show a significant reduction in fat component due to cellular replacement with marrow infiltration . In a previous study, Carroll et al. analyzed T1-weighted images of 74 patients with both benign and malignant bone marrow signal alterations on MRI (51 biopsy-proven, 23 clinical follow-ups) and compared relative signal intensity of bone marrow to adjacent skeletal muscle and/or nondegenerated intervertebral disk to establish standards on MRI differentiating infiltrative marrow pathology from hematopoietic marrow. It was summarized that marrow lesions that are relatively isointense or hypointense to muscle and/or disk on T1-weighted spin-echo images should not be considered normal hematopoietic marrow . In this context, Schweitzer et al. previously reported the “bull´s eye sign” as a specific indicator of normal hematopoietic marrow and the “halo sign” as a strong indicator of metastatic disease in 47 patients with osseous lesions of the pelvis evaluating T1- and T2-weighted sequences . The “bull´s eye sign” which describes a central high T1 signal in an osseous lesion, could not be found in our cases of hematopoietic islands. Thus, T1-weighted images are essential for the differentiation of sclerotic osteoblastic metastases with a strong hypointense signal equal to adjacent disc or muscle and focal hematopoietic islands with only moderate signal drop. STIR sequences provide high tissue contrast by suppressing fat signals. Thus, all pathologic processes, such as metastases, edema, and inflammation, show strong hyperintense signals. Normal bone marrow usually shows low signal intensity on STIR imaging . Five out of 14 lesions in our cohort showed isointense signals on STIR sequences compared to adjacent bone marrow, while nine showed slightly hyperintense signals. In contrast, osteolytic metastases typically show strong hyperintense signals on STIR sequences, while osteoblastic metastases show similar signal behavior to hematopoietic islands due to a lack of water protons . Thus, T2-weighted and STIR sequences do not help differentiate focal hematopoietic islands from osteoblastic metastases. After gadolinium administration, normal bone marrow enhances to a certain extent due to bone vascularity . Therefore, spinal marrow contrast enhancement depends on age and fat content and is significantly higher in hematopoietic marrow, characterized by a high percentage of fenestrated vessels and a low amount of poorly vascularized fat . Interestingly, younger individuals may show a rate of signal intensity increase, which is within the range typical of diffuse malignant marrow infiltration . The bone marrow enhancement decreases markedly with increasing age and fatty conversion, although significantly varying among individuals . This may be explained by interindividual differences in hematopoietic and fat distribution and might be associated with arteriosclerotic changes altering marrow perfusion in the elderly . This makes it difficult to distinguish normal from pathological enhancement patterns and has the consequence that contrast subtraction techniques have a limited significance. Typically, osteoblastic metastases show no or only slight contrast enhancement, while osteolytic lesions strongly enhance . After contrast administration, all hematopoietic islands showed minor enhancement in our cohort, which was more conspicuous in fat-saturated images. Thus, gadolinium cannot differentiate between osteoblastic metastases and focal hematopoietic islands but helps differentiate hematopoietic islands from osteolytic or mixed type metastases, which usually show substantial enhancement. There are no previous studies describing the signal behavior of hematopoietic islands after gadolinium administration. However, contrast administration is highly recommended in uncertain bony lesions . DWI is based on quantifying the motion of water molecules within tissue . Three patients in our cohort received DWI with obtaining SSFP sequences with relatively short acquisition time and insensitivity to patient movement. All examined hematopoietic islands presented as hypointense lesions when qualitatively compared to adjacent bone marrow. In previous studies, SSFP imaging was able to differentiate between malignant, depicted as hyperintense, and benign vertebral fractures depicted as iso- or hypointense compared to normal bone marrow . However, osteoblastic metastases may also present hypointensity on SSFP sequences due to sclerosis . Thus, DWI is not of definite value in distinguishing these two entities. CSI was used to quantitatively assess vertebral bone marrow's fat and water content on a voxel-by-voxel-basis, done in two patients in our cohort . In a previous study by Zajick et al. on 221 marrow lesions in 92 patients, a signal drop of more than 20% on out-of-phase images compared with in-phase images indicated benign lesions . By benign lesions, all hematopoietic islands in our patient cohort showed signal drops greater than this 20% threshold on out-of-phase images due to their fat content. In contrast, normal fat-containing marrow is replaced with high cellular tumorous tissue in malignant lesions. This increase in water protons is associated with a lack of suppression on the out-of-phase images . Thus, chemical shift imaging seems to be of value for the differentiation of hematopoietic islands of the axial skeleton and osteoblastic metastases. 18 F-FDG PET/CT was done on two patients. No increased FDG- uptake was found in both patients (cut-off value SUV max > 3). This is in contrast to a previous case report by Bordalo-Rodrigues et al. They reported a patient with lung carcinoma who received 18 F-FDG PET/CT examination as pretherapeutic staging, where increased uptake was noted in a biopsy-proven hematopoietic island in the vertebral body of Th8 . Considering this finding, it has to be stated that focal areas of normal but hypercellular red marrow may show increased uptake on FDG PET/CT and, therefore, may be confused with neoplasm or infection. This may be due to the upregulation of glucose transporters and metabolism in stimulated cells, also known for increased FDG-uptake in patients undergoing granulocyte-colony-stimulating-factor, which stimulates growth and differentiation of hematopoietic stem cells. However, in these cases- in contrast to hematopoietic islands- FDG-uptake is more diffuse . The hematopoietic activity in our lesions might have been too low to cause an increased FDG-uptake. In conclusion, it should be emphasized that hematopoietic islands may remain occult on FDG PET/CT. Therefore, this imaging modality is not of direct value for differentiating osteoblastic metastases and focal hematopoietic islands of the spine. One limitation of our study is the small number of patients. However, so far, there is little literature available on this topic. In addition, diagnosis-confirming CT-guided biopsy was obtained in only five patients. However, osteoblastic metastases could be ruled out by follow-up MRI in the remaining cases. As another limitation, patients with osteoblastic metastases were not included in this study. Regarding typical image characteristics of osteoblastic metastases, a reference was made to previous work. Furthermore, imaging parameters varied slightly between patients, and not all patients received DWI, CSI, and hybrid imaging. However, standard morphological MRI sequences were available in all patients, and gadolinium was applied in most cases (nine out of ten patients).
|
Review
|
biomedical
|
en
| 0.999998
|
PMC9124842
|
Mostly it is asymptomatic. Antenatally it is diagnosed by the absence of uterine serosa-bladder interface on ultrasound and increased placental vascularity (placental lakes ) on color doppler. MRI is done if the ultrasound report is inconclusive or to rule out bladder bowel involvement. A multidisciplinary approach is needed for the optimization of maternal outcomes. A planned cesarean section with obstetric hysterectomy reduces maternal morbidity and mortality. Conservative management can also be tried but the rate of secondary hysterectomy is usually high due to a series of life-threatening complications like postpartum hemorrhage, sepsis, deep vein thrombosis, pulmonary thromboembolism, septic shock, fistulas, etc. We hereby present a case of an intraoperatively diagnosed case of placenta percreta and its successful management. In addition to the rarity of the condition, the location of the placenta percreta was also intriguing. This case has been presented at the Pune Obstetrics and Gynaecological Society (POGS) rotating trophy conference on 21 September 2021. A 29-year-old gravida two, para one, living one with the previous cesarean at 39 weeks of gestation was referred from a nearby primary health care center with complaints of leaking per vaginum for ten hours. She had no other associated symptoms. Her antenatal period was uneventful with all routine investigations within normal limits. An anomaly scan was done at 19 weeks and was found to be normal. A growth scan done at 34 weeks was found to be corresponding to the period of gestation with adequate liquor and placenta at fundoposterior location. She had a previous cesarean section done five years ago in view of fetal distress. No other significant past medical or surgical history. A decision to perform an emergency cesarean section was taken. The indication was a previous cesarean section with prelabour rupture of membranes and poor bishop’s score. The abdomen was opened through a previous transverse scar under spinal anesthesia. The uterovescical pouch was opened and the bladder was pushed down. An incision was made in the lower uterine segment and a healthy male child of 2.6 kg was delivered. The placenta, however, could not be removed with gentle traction, and no plane of cleavage could be identified between the uterine wall and the placenta. The uterus was exteriorized and the placenta was found to have firmly adhered to the uterine wall and serosa on the fundal region . An intra-operative diagnosis of morbidly adherent placenta was made. The morbidly adherent placenta usually has a propensity to occur at the previous cesarean scar site (i.e lower uterine segment) but in our case, it was seen fundoposteriorly. This is what makes our case unique. This draws our attention to the fact that manual removal of the placenta in her previous cesarean section could have been the reason for the unnatural location of the placenta percreta. Routine manual removal of the placenta can damage the basal layer of the decidua and lead to complications in future pregnancies as probably happened in our case. Hence the practice of manual removal of the placenta should be discouraged and let it deliver on its own. This is an important message which we want to convey to all practicing surgeons through our article. Our case also highlights the unexpected and unplanned intraoperative recognition of placenta percreta and its life-saving management. Though rare, it is now an important cause of maternal morbidity and mortality. It is one of the leading causes of peripartum hysterectomy. Patients with previous cesarean section/s and an antepartum diagnosis of placenta previa are at the highest risk of placenta accrete. The risk increases with the number of previous cesarean sections. Other risk factors include previous uterine surgery (like curettage, myomectomy), submucous fibroids, uterine anomalies, and asherman’s syndrome. Women with previous cesarean scar found to have a placenta previa or an anterior placenta underlying the scar must undergo additional diagnostic imaging to confirm or exclude placenta accreta. Though greyscale ultrasound is still a basic imaging modality for the diagnosis of morbidly adherent placenta, newer ultrasound techniques like color Doppler and three-dimensional power Doppler have improved the positive and negative predictive value and the diagnostic accuracy . Loss of retroplacental sonolucent zone behind the placenta, placental lakes, or lacunae are suggestive of morbidly adherent placental MRI is a useful adjunct to ultrasound, especially in cases of the posterior placenta. MRI should be performed in all cases with an inconclusive ultrasound or Doppler and doubtful parametrial invasion.
|
Other
|
biomedical
|
en
| 0.999996
|
PMC9188782
|
Primary retinal lymphoma presenting as uveitis in a quiet eye in adults is the most frequent cause of masquerade syndrome . Hypopyon uveitis, although rare, has been reported in relapses of leukemia. Anterior segment involvement in acute lymphoblastic leukemia (ALL) is typically bilateral, occurs in 2.5% to 18% of cases, and almost all fall in the pediatric age group . Here, we describe an adult patient presenting with unilateral leukemic hypopyon uveitis and secondary glaucoma as an initial sign of ALL relapse. A 24-year-old male patient presented with sudden onset of diminution of vision, pain, redness, and watering in the left eye (LE) for a week. He was treated elsewhere as a case of steroid-induced glaucoma and was on oral acetazolamide thrice a day and topical anti-glaucoma medications (timolol maleate 0.5%, dorzolamide hydrochloride 2%, brimonidine tartrate 0.2%) in LE for six days. Two years earlier, he was diagnosed with ALL, received chemotherapy, and the maintenance phase was completed three months ago, with successful remission. Considering the clinical picture of non-resolving hypopyon and iris infiltrates, as well as the systemic history of the patient, masquerade syndrome was suspected. He was prescribed topical steroids (1% prednisolone acetate), cycloplegics, and anti-glaucoma medications were continued. A complete blood profile was done. However, the report was within the normal range. Moreover, the bone marrow aspiration done a few days ago showed no evidence of malignant cells. Nevertheless, the patient was advised to repeat the bone marrow aspiration and biopsy and was referred to the oncologist. Interestingly, the repeated bone marrow aspiration and biopsy showed 45% blasts indicating a relapse of ALL. Cerebrospinal fluid analysis for malignant cells was negative. He received hyper CVAD (cyclophosphamide, vincristine, adriamycin, and dexamethasone) chemotherapy as per protocol uneventfully. Ocular symptoms in leukemia can present after the systemic diagnosis, be the presenting signs of the disease, or be the first manifestation of relapse after remission, like in our case . Ophthalmic involvement is classified into two major categories, namely, primary/direct leukemic infiltration, mostly seen in relapse, or secondary/indirect involvement, commonly seen in the early phase of diagnosis. Ophthalmic screening of leukemia patients at the time of presentation and routine examination every six months (or earlier if there are ocular complaints) is warranted . Hypopyon uveitis associated with ALL relapse in adults has been reported previously in three cases (Table 1 ) .
|
Other
|
biomedical
|
en
| 0.999995
|
PMC9211773
|
The occurrence of primary pulmonary neoplasms in pediatric patients is uncommon. Inflammatory myofibroblastic tumor (IMT) is a rare neoplasm, which has a moderate risk of malignancy appearing mainly in children and young adults. 1 , 2 Its nature is in the majority of cases, benign and rarely can metastases however could commonly relapse. 3 This tumor is composed of several inflammatory cells, and the diversity of which ranges from mainly myofibroblastic cells to plasma cells in the pathological examination. 4 Inflammatory myofibroblastic tumor is defined as “a lesion composed of a proliferation of Myo‐fibroblastic spindle and stellate cells with abundant eosinophilic cytoplasm mixed with infiltrative plasma, inflammatory cells, lymphocytes, and eosinophils” in the World Health Organization (WHO). 5 IMT is known by numerous terms, including plasma cell granulomas, inflammatory pseudo‐tumor, fibrous histiocytoma, and pseudo‐lymphoma, 6 and may occur in a wide range of anatomical locations such as the lungs, omentum, bladder, spleen, breast, pancreas, liver, colon, spermatic cord, prostate, peripheral nerves, soft tissue, and orbit. About one‐third of these tumors are found in the respiratory tract. 6 We here report a case of IMT of the lung. A 9‐year‐old male child with chronic productive cough and occasional fever since 6 months ago was referred to our clinic. He had severe weight loss in this period. Two months before admission, he had massive hemoptysis. He had a history of tonsillectomy 2 years ago and no exposure to tuberculosis case. There was no history of the familial pulmonary disorder. At admission, his vital signs were stable (HR: 88/min, BP: 100/80 mmHg, RR: 18/min, and T: 37.2°C). In the examination, there was decreased pulmonary sound in the right lung. He had no positive drug or social history. Exposure to irritant substances or smoke was not reported with no history of allergy. There was clubbing in the upper and lower limbs' fingers. There was no shortness of breath or respiratory distress. There was no pathologic issue in his chest and abdominal sonography. His first laboratory data showed a leukocytosis (WBC 22,300 with PMN dominant pattern [85%]). ESR and CRP were in the nearly normal range. Anti‐Echinococus antibody was negative. Other laboratory data were in normal range. His chest X‐ray is shown in Figure 1 . In his pre‐admission computer tomography (CT) scan, a mass‐like foci in the right lung was reported. The pathologist assessed a wedge biopsy of the lung, with the brown outer surface, measuring 2.5 × 2 × 1 cm, and a central creamy‐yellow nodular lesion, measuring 1 cm in diameter. Sections of the lung tissue with pleural fibrous thickening reported, that is revealing prominent interstitial nodular lymphoid proliferations surrounding large epithelioid cells (resembling granulomas), and few of them with are large nucleolated cells without necrosis. A diffused intra‐alveolar infiltration of foamy histiocytes was noted. In addition, a central focus of pulmonary necrosis with mixed acute inflammatory cell infiltration (abscess formation) was present. Foci of hemorrhage were also reported. In Zhiel–Neelson staining, acid‐fast bacilli were not seen. PPD test was negative. Because of the nodular lymphoid proliferation of pulmonary interstitium with one necrotic area and abscess formation, it was suggestive of interstitial lymphocytic pneumonia or granulomatous disease and we ruled out it by checking CD20, CD3, CD15, and CD30 that have shown no definite evidence of Hodgkin lymphoma. Inflammatory myofibroblastic tumor (IMT) was diagnosed by its pattern . The patient was discharged after the surgery and is follow‐up now for probable relapse. The length of follow‐up was 3 years. Inflammatory myofibroblastic tumor was first described in the lungs but later was also found on other sites such as the orbit, spleen, genitourinary tract, mesentery, cardioesophageal junction, breast, central nervous system, and larynx. The larynx has been a very rare site for involvement in IMT. 9 Children with IMT may exhibit symptoms of chronic inflammation as a low‐grade fever, weight loss, anemia, thrombocytosis, polyclonal hyper‐gammaglobulinemia, and elevated sedimentation rate. Several cases are asymptomatic and are detected only incidentally in imaging studies. Among patients with endobronchial lesions, symptoms of bronchial irritation such as cough and hemoptysis may be accompanied by chest pain. 10 In our case, chest X‐ray, history of weight loss, and the occurrence of intermittent fever and hemoptysis, besides endemic status, made us suspicious of infectious processes like tuberculosis or echinococcosis. Because of the negative staining of the BAL sample and laboratory data, we thought about the non‐infectious process like malignancies because of weight loss. Despite doing bronchoscopy and HRCT, the diagnosis was last after histopathological assessment. According to previous studies, there are only 26 published cases of pediatric pulmonary IMT (the age between 3 and 13 years), even though the real incidence is presumed to be higher. 3 , 11 Peripheral lung lesions appear to be more frequent than central and endobronchial tumors that may be present about in 10% of the cases resulting in bronchial obstruction and atelectasis. 12 Inflammatory myofibroblastic tumor can be sometimes diagnosed as an incidental finding on a routine CXR. 13 In all previous cases, at the time of presentation, patients had a fever, respiratory distress, arthralgia, clubbing, night sweat, vomiting, and hemoptysis, and at the onset, fever and cough were the commonest symptoms. 3 There has been an ongoing controversy about whether an IMT is a reactive lesion or a true neoplasm. 14 Although its incidence is fairly scarce, the existing literature clearly defines its relative similarities in terms of clinico‐pathological and radiological findings and almost uniformly favors surgical resection as a mainstay for the most efficient management strategy. The recurrence rate remains low, and a 10‐year survival rate is around 80%. 15
|
Study
|
biomedical
|
en
| 0.999998
|
PMC9277097
|
Intravascular large B-cell lymphoma (IVLBCL) is a rare disease characterized by the proliferation of lymphoma cells within the lumina of small vessels. Even though early diagnosis and treatment are vital, the diagnosis is often delayed due to a variety of possible symptoms and the lack of detectable tumor masses. The new WHO classification for neoplasms and lymphomas distinguishes between two variants of IVLBCL : the classical variant, formerly the “Western variant,” presents with cutaneous involvement at diagnosis in 43% of patients and has a three-year overall survival of up to 81%, and a variant associated with the hemophagocytic syndrome, formerly “Asian variant” . The hemophagocytic syndrome-associated variant has an aggressive clinical course with involvement of the liver, spleen, and pancytopenia. The median survival time is less than eight months in these patients. Intensive Rituximab (R)-CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone)-like immunochemotherapy is currently the standard of care . Treating a rare disease like intravascular lymphoma is challenging. Due to the low incidence and large number of postmortem diagnoses, treatment recommendations for IVLBCL are largely based on retrospective studies and case reports. Standard R-CHOP achieves a complete remission rate of up to 90%, but the relapse rate is very high with a two-year progression-free survival (PFS) of only 56% . A recent study, the first prospective phase two study in IVLBCL, demonstrated that R-CHOP with high-dose methotrexate and intrathecal chemotherapy can improve two-year PFS to 76% . There is little data on autologous stem cell transplantation (ASCT) in dialysis-dependent patients and choosing an adequate regimen and dosing is difficult. A 42-year-old female presented with fever, hepatosplenomegaly, and pancytopenia. She was diagnosed with hemophagocytic lymphohistiocytosis (HLH) due to fulfilling six (fever, splenomegaly, bicytopenia, hypertriglyceridemia, high soluble interleukin-2-receptor (sIL-2R), and hemophagocytosis) of the eight diagnostic criteria . Extensive diagnostic workup, including wide-spectrum infectious disease tests, could not reveal an underlying disease. With ongoing clinical deterioration, treatment according to the HLH-94 protocol (six doses of etoposide 150 mg/m² and dexamethasone 10 mg/m 2 over four weeks) was begun . No clinical benefit but ongoing pancytopenia, fever, and progressive hepatosplenomegaly were observed. After four weeks of treatment, the patient developed severe hypoalbuminemia and a renal biopsy confirmed AA amyloidosis (SAA-alpha-mutation positive). Because of rising serum sIL-2R levels (≥13,000 U/ml) and a high sIL-2R/ferritin ratio (> 4.6), an occult lymphoma was suspected . The patient was then treated with six cycles of R-CHOP and achieved a complete remission. After four months, an early relapse of HLH occurred resulting in acute renal failure and dialysis dependency. A random liver biopsy was performed and immunohistochemical studies revealed strong CD20 expression and positivity for CD5, BCL2, CD10 (focal), and BCL6 (germinal center B-cell type). Tumor cells were negative for CD3 and MUM1, and MYC protein was not significantly expressed (<40%). These features were consistent with IVLBCL, and the patient was diagnosed with infiltration of the liver by an IVLBCL with co-expression of CD5, as seen in Figures 1A - 1B . As salvage treatment, she received R-GDP for five cycles resulting in a partial response. Stem cells were successfully harvested after the third cycle. Because of comorbidities (AA amyloidosis with severe hypoalbuminemia and end-stage renal disease), a modified, dose-reduced TEAM regimen was used as a high-dose conditioning regimen based on clinical pharmacologic considerations. The TEAM regimen consisted of thiotepa 5 mg/kg on Day -7, etoposide 100 mg/m 2 , and cytarabine 200 mg/m 2 once daily on Days -6 to -3, and melphalan 100 mg/m 2 on Day -2, as seen in Table 1 . No acute toxicity was observed after administration of high-dose chemotherapy. 2.94 x 10 6 CD34 + cells/kg were successfully transplanted. The patient developed grade three mucositis and grade four febrile neutropenia as adverse events after transplantation. Neutrophil engraftment was observed on day 16, and the time to platelet engraftment was 39 days. On Day 40, the sIL-2R level was elevated with progressive hepatosplenomegaly, but a bone marrow aspirate and a second liver biopsy showed no indication of lymphoma or hemophagocytosis. After more than a year of intensive treatments, the patient wished for an end to further therapy and dialysis. We respected the patient´s wish and proceeded with the best supportive care at our palliative unit. The patient died on Day 80 after ASCT. The clinical course of the patient can be seen in Figure 2 . A diagnostic pitfall was the failure to obtain histopathologic confirmation of the underlying lymphoma by blind liver biopsy at initial presentation. If an IVLBCL is suspected, a blind skin and liver biopsy are recommended . The time to definite diagnosis was nine months, as IVLBCL was not diagnosed before relapse. Protracted treatment may have paved the way for AA amyloidosis and subsequent terminal renal disease with dialysis dependency. As a result, optimal dosing of high-dose chemotherapy was complicated, and an allogeneic stem cell transplantation was no longer an option. As salvage therapy, R-GDP was chosen, and no adaptations were made to the regimen because all agents can be administered in dialysis-dependent patients. Cisplatin is dialyzable and dialysis was performed shortly after each cisplatin infusion . No grade three or four adverse events were seen after five cycles of R-GDP. In a retrospective study evaluating ASCT in IVLBCL, most patients received BEAM (carmustine, etoposide, cytarabine, and melphalan) as the conditioning regimen with a two-year overall survival of 91% . For conditioning therapy, we decided to use a modified TEAM regimen instead of BEAM due to the risk of acute and late toxicities of carmustine . In dialysis-dependent patients, finding the optimal dosing for conditioning therapy before transplantation is difficult due to the risk of overdosing and increased toxicity or underdosing, and insufficient disease control. Dose adaptations were made according to reports regarding the pharmacokinetics of these agents. Most data for use as a conditioning regimen exist for melphalan, as it is used frequently in dialysis-dependent multiple myeloma patients with a recommended dose of 100 mg/m 2 . The cytarabine metabolite uracil arabinoside (Ara-U) accumulates in patients with renal failure and is suspected to explain the increased cytarabine neurotoxicity in patients with renal impairment . Thus, the cytarabine dose was reduced to 200 mg/m 2 once daily, which equals a dose reduction of 50%. Etoposide is not eliminated by hemodialysis, however, in a case series, a 50% dose reduction had good efficacy without additional adverse events in patients receiving dialysis . While there are no reports of thiotepa in patients receiving dialysis, there is one case report about the pharmacokinetics of thiotepa in a patient with moderate renal insufficiency. Exposure to TEPA (N,N',N"-triethylenephosphoramide), the main and active metabolite of thiotepa with similar alkylating properties, was increased by about 150% with the split application over four days. Exposure of other metabolites (monochloro TEPA, thioTEPA mercapturate) was not quantified . The pharmacokinetics of thiotepa is dose-dependent and with normal renal function, less than 1% of unchanged thiotepa is found in the urine. Approximately 10% of the administered dose is recovered in urine as TEPA or as thioTEPA mercapturate, respectively, whereas recovery of monochloro TEPA was less than 1% . Given the known pharmacokinetics of thiotepa and its metabolites (low molecular weight, low protein binding, moderate apparent volume of distribution), we assumed that thiotepa could likely be eliminated by hemodialysis and no dose reductions were made. With a typical half-life of 2.3 hours, most of the administered thiotepa should be eliminated after 12 hours. The time with alkylating activity is probably longer due to the TEPA half-life of approximately 10 hours . Therefore, the first dialysis was set to 12 hours after thiotepa infusion in order to allow for (presumably) normal thiotepa exposure and to limit potentially prolonged exposure to active thiotepa metabolites. The main adverse events of thiotepa are mucositis and temporary central nervous system toxicity, and our patient developed grade three mucositis which resolved quickly . The presented case illustrates that a modified TEAM regimen is feasible in a patient with end-stage renal disease with manageable toxicity. To our knowledge, this is the first report of thiotepa in a dialysis-dependent patient. Due to the rapidly progressive and fatal course of IVLBCL, it is essential to aim for aggressive, i.e. blind multiorgan biopsy particularly in patients, where HLH-associated lymphoma is suspected. Early, aggressive treatment with R-CHOP or R-CHOEP and high-dose chemotherapy with ASCT should be considered in high-risk and eligible patients.
|
Review
|
biomedical
|
en
| 0.999997
|
PMC9328483
|
Sialadenoma papilliferum (SP) is a rare, benign neoplasm arising from the minor salivary glands of the oral cavity ( 1 , 2 ). It comprises less than 1% of all minor salivary gland tumours (SGTs) ( 1 , 3 , 4 ). According to the literature, patient age at diagnosis ranges from 2 to 91 years, with a mean age of 59 years ( 2 – 5 ). Both sexes are equally affected ( 6 ). The most common location is the hard palate (80%), followed by buccal mucosa, upper lip, retromolar pad, and parotid gland ( 1 – 3 , 7 ). Lesions usually do not exceed a diameter of 2 cm, often being less than one cm ( 1 , 2 , 7 ). SP often appears as a white, exophytic, round, asymptomatic, well-circumscribed, slow-growing mass with a papillary surface ( 2 , 4 , 7 ). The most common differential diagnosis should screen for malignancy, squamous cell papilloma, hemangioma, fibroma, and mucocele ( 1 , 2 ). SP is not related to human papillomavirus (HPV), although the clinical appearance may be similar to squamous cell papilloma ( 4 , 7 ). A 90-year-old woman was referred for dental examination in the public Oral Health Care Center of Turku prior to planned arthroplasty and prosthetization of both shoulder joints. The patient, although elderly, was in stable general health and was taking Amitriptyline® for arthritic pain, and Furosemide® and Warfarin® daily for well-controlled cardiac failure and atrial fibrillation. Her teeth had been extracted more than 50 years previously, and her full-arch dentures fit well. Of note, the patient records revealed that a small, reddish lesion was described in the hard palate three years earlier. The lesion was regarded as inflammation of a minor salivary duct opening, and further investigations or follow-up were not arranged. SP is a rare, benign SGT, with only a few cases described in the literature. Oncocytic metaplasia has been shown in the histology of SP previously ( 1 ), and recently Hsieh et al . ( 5 ) suggested that SP has two histological variants, namely classic and oncocytic. Our patient case represents an oncocytic type of SP in which the papillary endophytic ductal component composed of oncocytic cells merges with the stratified epithelium above forming papillary structures . Classic SP, in turn, has a papillary squamous surface and an endophytic part of ductal structures that is composed of columnar or cuboidal cells forming bilayered or multilayered structures ( 5 , 10 ). Interestingly, Hsieh et al . ( 5 ) showed that conventional SP presents with SOX10 expression and BRAF V600E mutations comparably to syringocystadenoma papilliferum of the skin, whereas the oncocytic variant of SP lacks BRAF mutations and does not express SOX10. Inflammation and sialolithiasis have been suggested as etiologic factors for SP. In our case, the inflamed salivary duct opening noted several years prior to SP diagnosis may have contributed to SP development ( 6 ). Importantly, the palate has an abundant quantity of minor salivary glands, offering a common site for different SGTs. Unfortunately, in the oral cavity, malignancies comprise 50% of SGTs ( 11 ). In Finland and Denmark, adenoid cystic carcinoma (ACC) is the most common malignant SGT, followed by mucoepidermoid carcinoma ( 12 , 13 ), and in the oral cavity ACC is diagnosed commonly in the palate ( 14 ). Bearing this fact in mind, planning the surgical removal of a suspected SGT is important to ensure adequate excision margins. Owing to the generally indolent and benign nature of SP, a local excision usually results in a cure. Nevertheless, malignant transformation in regions of SP has been observed and should prompt the clinician to ensure the complete removal of tumor tissue ( 8 ). In our case, no erosion of palatal bone was detected, although lytic bone lesions owing to SP are possible, albeit readily removed by curettage ( 15 ). Our patient was scheduled for a local excision of the tumor. Koc and coworkers ( 15 ) described the first removal of SP using robotic surgery (TORS), which might facilitate the minimally invasive excision of SP from anatomically difficult areas in the future. Lastly, adequate follow-up to detect possible recurrences plays an important role in managing patients with this rare tumor.
|
Review
|
biomedical
|
en
| 0.999998
|
PMC9366027
|
Partial anomalous pulmonary venous return (PAPVR) is a spectrum of congenital cardiovascular abnormalities. The overall incidence of PAPVR is estimated to be 0.7 percent of the population . In 1739, Winslow described this syndrome as a remaining embryonic connection between the systemic and pulmonary venous plexus . The most common variant of this syndrome involves a connection between the right pulmonary vein and the systemic circulation involving either the superior vena cava (SVC) or the right atrium (RA); but it can also involve the coronary sinus, the inferior vena cava or the brachiocephalic vein . PAPVR is uniquely found incidentally with no clinical symptoms. Subsequently, the patient was referred by the cardiology team to the cardiothoracic team for surgical management, where she underwent a modified Warden procedure. There was a creation of secundum atrial septal defect, enlargement of tiny sinus venous defect, patch closure of right superior vena cava-right atrium junction with patch pericardium, tricuspid valve repair, and creation of baffle between right upper and lower pulmonary veins to the left atrium. Her postoperative course was uneventful. She was discharged on 1L oxygen by nasal cannula for persistent nocturnal hypoxemia. She was treated with anticoagulation for three months and now takes aspirin. The patient went to cardiac rehabilitation after surgery for six weeks. She is currently doing well, with no restrictions. She is doing water aerobics which is going well for her. Patients with PAPVR have a wide variety of clinical manifestations, including fatigue and dyspnea progressing to heart failure as well as recurrent pneumonia. Symptoms are usually dependent on the size of the left to right shunt and if there is an associated cardiac defect, including an atrial septal defect (ASD), for instance. In fact, the physiology of ASD is the same as that of PAPVR . Moreover, the physical exam is clinically benign. However, cyanosis findings could be detected if there is a severe progression of the shunt. Also, a murmur of ASD could be found in case of its presence. Our patient was clinically asymptomatic, and PAPVR was identified incidentally with thoracic imaging. In terms of the evaluation of PAH, transthoracic echocardiography (TTE) remains the gold standard diagnostic tool for identifying anomalous veins, while cardiac MRI and CT angiography (CTA) are superior in the evaluation of extracardiac vascular anatomy . Moreover, cardiac MRI is a non-invasive diagnostic modality that enables the identification of the number of systemic veins, their origin, course, and site of drainage. In addition, cardiac MRI can detect atrial septal defects by identifying their type . In our case, a TTE was performed, and it was sufficient for the diagnosis. The modality of treatment varies depending on the patients' presentation and symptoms. Surgical repair is recommended when there are symptoms caused by the shunt, when there is more than one anomalous vein involved, and if the shunt is moderate or large in severity. Hence, surgery would result in reducing the right ventricle (RV) size and pulmonary hypertension (PA) pressure. However, surgical repair can be challenging with the risk of causing thrombosis to the surgically operated vein . The Warden procedure, reported in 1984, has been widely used for surgically correcting PAPVC, which connects to the SVC. Although the procedure has been effective in decreasing the risk of SVC or pulmonary venous obstruction, there have been a few complications after the procedure, including pulmonary venous obstruction, SVC obstruction, and sinus node dysfunction, warranting close serial follow-up . In our case, a surgical approach was recommended by the cardiothoracic team due to the presence of symptoms related to the shunt fraction.
|
Review
|
biomedical
|
en
| 0.999998
|
PMC9387771
|
Recent research has revealed that the prosthesis embodiment is a key point during the rehabilitation and adaptation after amputation , bringing a series of benefits: more intuitive control, facilitation of learning , restoration of the perception of bodily integrity , and assisting in the treatment of phantom pain and residual limb pain . These aspects together make possible a better physical, psychological, and cognitive adaptation, optimizing the rehabilitation process and acceptance of the prosthetic limb. Several studies have corroborated this concept of embodiment, showing that people with amputation can better perceive the prosthesis when it is voluntarily controlled and/or provides somatosensory feedback . Taking this into account, an EMG-based human-machine interface (HMI) is a type of system based on voluntary control and corresponded sensory feedback. This closed loop allows gradual and consistent learning of the individual’s control ability . Furthermore, it contains important aspects underlying the device embodiment, volition and sensory stimulation . Thus, EMG-based HMI training provides a real-time paradigm to study the embodiment process and for use as a complementary therapeutic option. The manner in which feedback is presented is a crucial factor for learning . An interesting option that has recently emerged is the use of virtual reality (VR). Protocols involving VR are applicable in different clinical contexts , including as part of training before the use of the physical prosthesis, for people with amputations . Furthermore, there is an extensive literature corroborating the embodiment of bodies, limbs, or virtual objects . Considering that the learning acquired in a VR environment is transferable to the physical environment , the induction of virtual prosthesis embodiment could help the process of training and adaptation to the use of a physical prosthesis. The EMG-based HMI was designed in a way that the participants could control the movements of a prosthesis immersed in a VR environment using the myoelectric activity of the residual limb, while receiving non-invasive vibrotactile stimuli applied on their back, which were mapped to represent the movements of the virtual prosthesis. The training was applied during the preprosthetic rehabilitation phase of people with transfemoral amputation. The hypothesis was that training with this EMG-based HMI, could induce and enhance virtual prosthesis embodiment. For the inclusion of participants in the research, the following criteria were adopted: people with unilateral transfemoral amputation, both sexes, age between 18 and 46 years, and without previous use of prostheses. People who had open skin lesions on the residual limb or back, uncorrected visual impairment or associated neurological diseases were excluded from participation in the study. The participants provided written consent prior to the start of the study, and all ethical recommendations were followed. The activity of the rectus femoris (hip flexor and knee extensor) and femoral biceps long head or semitendinosus muscles (hip extensors and knee flexors) on the residual limb was recorded using surface electromyography (EMG). Electrode placement for each muscle and participant was determined by applying excitomotor electrical current stimulation and visualizing the muscle contraction response. These positions were mapped for each person and used in all training sessions. Two channels of an Intan Technologies ® chip were used to amplify the electrophysiological signals, and the chip was connected to the OpenEphys ® analog-digital converter board in communication with its software . The electrophysiological signals were sampled at a rate of 10 kHz . To control the feedback, two criteria needed to be satisfied: (a) Agonist muscle activation threshold. The RMS of the agonist muscle signals had to be greater than 2 standard deviations (SD) in relation to the baseline signal for the system to recognize the direction of movement (knee extension or flexion). (b) Tolerance of antagonist muscle contraction. Initially, the RMS of the antagonist muscle could not exceed 80% in relation to the agonist muscle (this parametrization was also used as a criterion for the progression in difficulty levels during training). Therefore, a higher level of EMG activity associated with the hip flexor muscle resulted in the knee extension movement of the virtual prosthesis and, simultaneously, in an upward vibrotactile stimulation pattern on the subject’s back. A higher level of EMG activity associated with the hip extensor muscle resulted in knee flexion of the virtual prosthesis and, simultaneously, in a downward vibrotactile stimulation pattern on the subject’s back . For more details about the definition of the vibrotactile stimulation pattern, see Supplementary Figure 1 in the Supplementary Material . The virtual environment was developed on the Unity3D ® platform . The environment was conceived to simulate a regular clinical room where the users could see themselves in a first-person perspective as a humanoid avatar using a transfemoral prosthesis in the corresponded lower limb. The subjects were able to control the knee extension and flexion movements of the prosthetic limb within a range between 0° and 90° . Moreover, the virtual environment was designed to enable gamification of the protocol with different stages and motivational messages to reinforce learning. The participants accessed the virtual environment using a Samsung ® Odyssey Oculus Head-Mounted Display that provided a first-person view in a fixed sitting position and the ability to visually explore the whole 3D virtual environment. For more details about VR environment see Supplementary Material ( Supplementary Table 2 ). A total of 16 vibrotactile actuators (10 mm × 6 mm; 5 V-DC) were assembled in a 4 × 4 matrix and positioned on the subject’s back , with an average distance of 6 cm among them. Vibrotactile stimulation was applied at frequencies between 260 and 330 Hz, which is optimal for stimulating Pacinian corpuscles, the main skin vibration receptors . Vibrotactile actuators were arranged in groups of 4 (organized by rows on the back), and each group was activated together (actuator activation was performed through an Arduino ® platform communicating in real time with MATLAB ® . All actuators placed along the same row vibrated with the same intensity, with maximum intensity when the virtual prosthesis was positioned at a specific movement angle (0°, 30°, 60°, or 90°); there was a vibratory overlap of 30° with the adjacent rows to produce a continuity effect on vibratory perception . For more details on the vibrotactile stimulation device see Supplementary Table 3 and Supplementary Figure 2 in the Supplementary Material . Two preliminary sessions were conducted prior to the start of the training protocol to familiarize participants with the EMG-based HMI. In these sessions, the participants learned to associate the residual limb muscular contraction with virtual prosthesis movements . After this stage, the training was based on an operant conditioning paradigm, in which there was a progressive increase in the difficulty of the tasks with contingent feedback and rewards to reinforce learning. Overall, contingent feedback itself has a positively reinforcing effect, but this was supplemented with motivational messages, such as “congratulations,” at the end of each task block . In total, six training sessions lasting 30 mins each, consisting of task blocks involving motor control were conducted twice a week. The maximum of task blocks was performed within the 30 mins. For each task, the participants moved the virtual prosthesis until they reached a specific predefined position set at four target angles: 0°, 30°, 60° or 90° (a combination of angles with targets at 0°, 45°, and 90° was also used as a preliminary stage for each new level of difficulty). To guide the movements in real time, the participants were presented with a visual clue (semicircular ruler) indicating the position to which they should move the virtual prosthesis . The following criteria were adopted to increase the task difficulty: (a) Tolerance of antagonist muscle contraction. Antagonist muscle activation up to 80% in relation to agonist was initially established, which decreased by 10% at each new difficulty level; (b) Precision of movement. For a task to be considered correctly performed, a range of positions was adopted in relation to the target angle. The difficulty levels varied from the target angle as follows: ±15°, ±10°, and ± 5°. Therefore, initially, there was no need for refined muscle control (regarding the isolation of agonist muscle contraction) and movement precision. However, this became necessary as the difficulty gradually increased . In this manner, given a particular difficulty combination (tolerance of antagonist muscle contraction and precision of movement), the participants performed a preliminary block and then a task block composed of a set of target angles, 0°, 30°, 60°, and 90° (each presented randomly four times), for a total of sixteen tasks for each block. After an attempt of 20 s, or if the target angle was hit, the next task was presented (if the participant did not hit the task within 20 s, it was considered a failure, although the participant did not receive any messages indicating the failure). The performance was assessed at the end of the task block, and the difficulty was increased if the participant had a success rate of 75% (this cutoff was heuristically calculated from previous pilot studies) or more; otherwise, the same difficulty combination was performed again. We assessed a set of measurements to examine the induction and enhancement of virtual prosthesis embodiment. This test set was selected based on affective, spatial perception, and motor mechanisms. These three features were proposed by De Vignemont and underlie the development of the object’s embodiment. In addition, we investigated self-perception regarding the sense of ownership and agency. Affective, spatial perception and self-perception measurements were assessed at the beginning and end of the experimental protocol. Motor measurement was performed in all training sessions. Skin conductance response (SCR) was used to detect inherent physiological responses when the virtual prosthesis was threatened . SCR acquisition was accomplished using the e-Health ® (2.0) system coupled to an Arduino Uno ® , with a sampling rate of 20 Hz. The SCR recording was performed at the initial session and at the penultimate training session; for this, surface electrodes (Ag/AgCl) were placed on the intermediate phalanx of the second and third left hand fingers . This recording was made 2 mins before and during the simulation of a threat−a chandelier falling on the virtual prosthesis . At the beginning of the training sessions, all participants watched a video showing the fall of the chandelier on the virtual prosthesis, and they were informed that at some point during the sessions, the same event could occur, thereby minimizing the effects of surprise on the measurements . The participants did not know on which day this test would be conducted. Finally, the magnitude of the SCR was analyzed . A crossmodal congruency task (CCT) involving a visual stimulus (visual distractors on the virtual body) and a concomitant tactile stimulus (vibratory stimulation of the participant’s back) and the respective crossmodal congruency effect (CCE) were used to identify visuotactile interference in the peripersonal space . To perform this task, the participants visualized the lower limbs of the avatar and a luminous point (visual distractor) in four different positions: on either side of the hallux or heel. In addition, four vibrotactile actuators were positioned on the participants’ backs: two were placed in the thoracic region, and two were placed in the lumbar region on both sides. Therefore, there were 16 possible stimulus combinations: 4 positions of the visual distractors and 4 positions related to the vibratory stimuli, and each combination was randomly presented four times for a total of 64 repetitions in each task block. A visual distractor was presented and followed 100 ms later by vibrating stimulation for 350 ms. The participants were then instructed to press a button based on the place on their back that they had received the vibratory stimulation while ignoring the visual distractor. They had two options: upper (thoracic) or lower (lumbar). If the participant did not press the button within 2 s, the next combination was presented. The CCT protocol consisted of observing the virtual prosthesis performing knee flexion and extension movement (at an angular speed of 45°/s for 1 min) with or without concomitant vibratory stimulation related to virtual prosthesis movements. This observation sequence was random, and the CCT task block was performed after each paradigm. All participants previously underwent training and started this task only after reaching an accuracy of 85% in localizing the vibratory stimulus. In this manner, the CCE was calculated as the difference in the reaction time between incongruent (for instance, when a visual distractor was localized on the upper part of the foot and the vibratory stimulation was in the lumbar region) and congruent conditions (for instance, when a visual distractor was localized on the upper part of the foot and the vibratory stimulation was in the thoracic region) . To compare SCR magnitudes among the 4 different periods (before and after the threat, at the beginning and end of the experimental protocol) a two-way ANOVA was used with a Tukey-Kramer post hoc correction. A one-way MANOVA was applied followed by canonical discriminant analysis to determine whether the set of variables (SCR amplitude waveforms) exhibited specific clusters based on each period of threat exposure. The SCR signal analysis, the following steps were performed: (a) smoothing the original x(t) signal by averaging it over a 3-s sliding window with 50% overlap along the whole signal and producing a x′(t) signal; (b) calculating the phase signal from the difference y(t) = x(t)−x′(t); and (c) applying a logarithmic scale over the magnitude of the signals and considering the 3 s of signal before and 3 s after the application of the visual stimulus (i.e., the moment when the chandelier enters the visual field of the participant within the VR environment) . The SCR signals from participant “B” were excluded from the analysis due to noise issues during registration. Statistical comparisons were performed between CCE averages considering that the visual and tactile stimuli were applied on the same and the opposite side. Thus, a two-way ANOVA with Tukey-Kramer post hoc correction was applied for this comparison. The CCE calculations, the only data that were included were from correct executions, while times greater than 1500 ms and less than 200 ms were excluded (3.4% of all trials) . The prior visualization of the virtual prosthesis movements with and without associated vibrotactile stimulation were both considered statistical factors at the beginning and end of the protocol. The following variables were analyzed: (a) execution time and (b) success rate. The target angles were separated into intermediate (30° and 60°) and extreme (0° and 90°) angles. In addition, the data were grouped into three difficulty levels related to the precision of movements, i.e., 15°, 10°, and 5° to the target angle. The task execution times were compared among these three difficulty levels while separately considering the intermediate and extreme target angles (Kruskal−Wallis test followed by Tukey-Kramer post hoc correction). Comparisons among execution times, while considering the intermediate and extreme target angles, were also performed (using the Mann−Whitney test), as well as the analysis of success rates by comparing among average proportions and confidence interval (CI) (95%). All participants reacted affectively to a threat to the virtual prosthesis (inside the virtual environment, a chandelier fall over the prosthesis). The affective response was indicated by a significant increase in SCR after the threatening event ( F = 53.3, p < 0.001), both at the beginning ( post hoc p < 0.001−before and after the threat) and at the end of the experimental protocol ( post hoc p < 0.001−before and after the threat). At the end with greater magnitude compared to the beginning ( F = 85.15, p < 0.001; post hoc p < 0.001−before the threat at the end and beginning; after the threat at the end and beginning) . Motor training with the EMG-based HMI provided an improvement in the ability to control the virtual prosthesis, considering that there was a success rate > 75%, even with the progressive increase in the difficulty of the tasks . However, although the success rate was always high, the execution time was longer in the more difficult/complex conditions. With intermediate angles (30° and 60°), the time to execute the tasks was longer than with extreme target angles (0° and 90°) regardless of the precision of movement required during the task (precision of movement 15°: U = 263, p = 0.006; 10°: U = 288, p < 0.001; 5°: U = 301, p < 0.001) . The difficulty associated with greater movement precision (5° range in relation to the target angle) also demanded significantly more time for task execution (H = 18.038, p < 0.001; post hoc p < 0.001 – 5° and 15°; p = 0.019 − 5° and 10°) . The results of this study showed that there was induction and enhancement of virtual prosthesis embodiment through training with an EMG-based HMI. We observed that the affective response was immediate, but with training, there was an amplification of this response. These findings, along with the recalibration of the peripersonal space and the increased control capacity with training, showed an improvement in the embodiment over time. The high indices of self-perception declared by the subjects regarding their sense of ownership and agency over the virtual prosthesis also corroborated this. All participants reacted affectively to a threat to the virtual prosthesis, indicated by a significant increase in SCR magnitude, which is a natural physiological reaction to a threat to the subject’s own bodies . This response already occurred at the beginning of the protocol, but there was a significant increase at the end, indicating an amplification. Other studies with manipulations of body perception, such as those based on the rubber hand illusion (RHI) paradigm , have also identified an increase in SCR by threatening an external object, indicating embodiment . In the present study, the increase in SCR magnitude at the beginning of the protocol, suggested that there must have different levels of embodiment, since a few minutes of training to control the virtual prosthesis movements was enough to achieve some embodiment. An explanation for this immediate response may be associated with virtual environment immersion: with no visual feedback from their own body and only a visualization of the virtual body from the first-person perspective, there is a decreased incompatibility between real and virtual body perception in terms of visual, proprioceptive and spatial recognition . This idea is also supported by previous studies that point out that this anatomical congruence between the body itself and an intact virtual limb is sufficient to induce embodiment, even without visuomotor or visuotactile stimulation . The highest CCE values were obtained when the stimuli were applied on the same side of the body than on the opposite sides at the end of the training, indicating that the visual stimuli applied in the virtual environment were considered close to the real body. In other words, there was a recalibration of the peripersonal space to include the virtual prosthesis . Although the size of our limbs determines our reach space, the use of tools can alter peripersonal space −a neurocognitive representation produced from the integration of sensory information related to the body itself and the space around it . Other studies using immersion in virtual environments have also shown that it is possible to extend the peripersonal space to include a tool or virtual limb in an equivalent manner to what is produced in physical environments . The absence of significant CCE differences at the beginning of the training indicated that the recalibration of the peripersonal space is not immediate and depends on exposure/training, unlike the autonomic/affective response. In the same line of interpretation, Marini et al. , in an experiment using a functional prosthesis, observed that the recalibration of the peripersonal space occurred only after a long period of training. Other studies have also pointed out that the stable recalibration of the peripersonal space depends on the development of skills and prolonged use of a tool or assistive device . Considering all this together, our interpretation is that the autonomic/affective response is dependent on the visual and proprioceptive congruence of the real and virtual body experienced through the first-person perspective . The recalibration of the peripersonal space may be linked to the processing of body perception depending on learning motor skills acquired during the training sessions . However, the increase in SCR magnitude and high correlation with the CCE at the end of the protocol indicated that the affective response, although it was immediate, was also strengthened during the learning process, suggesting that the embodiment can have different levels of intensity. The time required for the participants to perform the tasks was longer for the intermediate target angles (30° and 60°) than for the extremities (0° and 90°). For the intermediate angles, the time was even greater when the task required greater precision. The differences in these times can be explained by the level of complexity of the motor control strategies: simpler strategies in the case of extremity angles and more complex strategies for reproducing intermediate target angles, especially in more precise tasks. This interpretation can be supported by motor control theories based on feedforward and feedback mechanisms . In conditions where movement strategies were simpler, motor control occurred largely through feedforward mechanisms from the estimation of sensory consequences using copies of the efferent motor commands. In this way, for the extreme angles, the execution times were shorter because the predicted movements did not require major corrections during the execution. However, during tasks with more complex motor control strategies, those with intermediate target angles and higher precision, motor control occurred mainly through the sensory feedback by comparing predicted and actual movements . In these cases, corrections, and adjustments of the movement in real-time were determinant and explained the longer execution times during these tasks. Participants reported high self-perception that the virtual prosthesis was part of their own body and that they could voluntarily control it. This perception remained stable or increased over the course of the training in most cases. Only two participants (C and D) reported a decreased sense of agency at the end of the protocol. However, for both, the score given in the initial evaluation for the agency sense was already the maximum value. Most likely, this result was related to the expectations created by these participants that control would be easier throughout the sessions, which did not occur due to the progressive difficulty increasing imposed during training. Additionally, it is worth noting that this effect did not affect their sense of ownership since both reported an increasing of ownership at the end of the training, which reinforces this interpretation. The reports of some participants who felt the phantom limb were also interesting and corroborate the self-perception of ownership and agency over the virtual prosthesis: participant C reported that at the end of the protocol he could control the movements of the phantom limb, which he could not do before. Participant E had control over the movements of the phantom limb from the beginning and reported that he used the same strategy to flex the phantom limb to control the knee flexion movement of the virtual prosthesis. Participant F felt the phantom limb in constant flexion and could not move it. However, during the protocol in immersion VR environment, she could actively flex the phantom limb together with the virtual prosthesis movement (“It’s like I have two legs moving”). The embodiment of an external object is a complex concept and experience. Currently, the literature shows an overlap of terms and definitions . Here we based our protocol mostly on the definition provided by De Vignemont ; Makin et al. , where there are more practical aspects to be implemented in the therapeutic context: “the ability to process properties of this object at the sensory, motor and/or affective levels in the same way that the properties of one’s own body parts.” This definition is interesting because it inherently brings an ecological and interactive perspective, where the embodiment of an external object can only be achieved if the subjects systematically interact with the environment (including the object itself) through specific sensorimotor criteria.
|
Other
|
biomedical
|
en
| 0.999996
|
PMC9434960
|
Coronavirus disease (COVID-19) caused by SARS-CoV-2 infection has elicited the ongoing pandemic with unprecedented impact on healthcare systems and over 6 million deaths by June 2022 ( 1 ). Evidence from well-designed clinical trials has enabled management for the majority of patients with COVID-19. However, conclusions from these trials may not apply to the cohort of immunocompromised patients in whom diagnostics, treatment, and surveillance still represent a significant challenge ( 2 ). Certain immunocompromised patients may develop persistent SARS-CoV-2 infection. The literature data regarding their potential for viral transmission, mutation accumulation, and possible further immunosuppression are scarce ( 3 , 4 ). This patient cohort is also prone to developing opportunistic infections driven by chronic immunosuppressive therapy and persistent viral infection. Nocardiosis is a rare infection in the form of a localized or disseminated disease caused by aerobic, weak acid-fast, branching bacilli of the Nocardia genus ( 5 ). They widely inhabit soil, water, and decomposing organic material and usually cause infection by inhalation or skin inoculation. Patients with cell-mediated immunodeficiency seem to be at higher risk ( 6 ). Nocardial brain abscess is exceptionally infrequent, making up around 2% of all brain abscesses ( 7 ). They can be misdiagnosed as tumors or brain metastases due to mass lesions seen on imaging, and a relatively silent clinical course. Despite the advancements in antimicrobial therapy, mortality of nocardial brain abscesses remains high and exceeds three times that associated with other bacterial pathogens ( 7 ). On November 25, 2020, a 30-year-old woman with a 13-year history of systemic lupus erythematosus (SLE) exhibited painful leg swelling and was diagnosed with deep venous thrombosis (DVT). She was treated with enoxaparin, followed by an oral anticoagulant (warfarin). Her SLE initially presented as proteinuria, nephritis, and autoimmune hemolytic anemia was well-controlled and stable. She was treated during the last year with mycophenolate mofetil 250mg twice daily, prednisone 20mg/d, and hydroxychloroquine 200 mg/d. Several days following the development of DVT, the patient manifested symptoms of respiratory infection (subfebrile temperature up to 37.3°C, weakness, anosmia). She was tested (PCR of the nasopharyngeal swab) and found to be positive for SARS-CoV-2 on December 8. Due to the mild course of the disease, normal chest radiography, and good oxygen saturation of 99%, she was prescribed therapy and kept in home isolation. Nevertheless, the recovery from COVID-19 was not satisfactory as the patient complained of shortness of breath, persistent dull chest pain, extreme exhaustion, and tachycardia up to 130 bpm for weeks after the onset of the infection. She visited her immunologist on January 21, 2021. The laboratory analyses showed elevated inflammatory markers (CRP 27.5 mg/l [<5 mg/l]), d-dimer 3990 [<500], LDH 589 IU/l, WBC 8.3 × 10 9 /l, Lymphocyte 0.4 × 10 9 /l, and INR 1.93. Immunological analyses (Anti-nuclear antibodies -ANA, anti-Cardiolipin antibodies – aCLA IgM and IgG, anti-beta2 glycoprotein1 – anti-β 2 GPI IgM and IgG, lupus anticoagulant – LAC) were negative, total serum IgM and IgG were in the normal range, while total IgA was 0.62 g/l [0.8–2.4]. Computed tomographic pulmonary angiography (CTPA) demonstrated massive pulmonary embolism with the clot at the main branching of the pulmonary artery. She was hospitalized and treated until discharge home on February 8. Due to an allergy to warfarin, she has been prescribed rivaroxaban as further therapy. Two weeks following hospital discharge, the patient’s symptoms aggravated as she manifested morning fever up to 39°C, intense fatigue, dry cough, and chest pain. The persistence of these symptoms was the basis for admission to the pulmonology unit on March 12. On admission, she was slightly dyspneic with an oxygen saturation of 95% on room air. She had marked lymphopenia (0.3 × 10 9 /l), elevated CRP (91.9 mg/l), normal procalcitonin (0.05 ng/ml), and anemia (hemoglobin 91 g/L) with high ferritin value (856 μg/l). Initial chest CT scan demonstrated a multilocular irregular cystic formation (45 × 35 × 45 mm) in the right middle lobe adjacent to the visceral pleura, surrounded by a “tree in buds” appearance. It also showed ground-glass opacities (GGO) in both inferior lobes and the right middle lobe with the posterolateral and subpleural distribution. We performed ultrasound-guided lung biopsy to obtain samples to refer to microbiology and cytology analyses. They showed dense infiltration with lymphocytes, erythrocytes, and neutrophils, without malignant cells, while the microbiological culture showed no growth of microorganisms. Fiberoptic bronchoscopy revealed normal findings, and the specimen demonstrated rare neutrophils and Pseudomonas spp. (over 1 million CFU/mL) sensitive to amikacin. Hemoculture was negative, and the infection with Mycobacterium tuberculosis was excluded with smear acid-fast staining, PCR, MGIT culture test, Quantiferon TB Gold blood test, and negative Lowenstein culture growth. Galactomannan antigen (serum and bronchoalveolar) were negative, while serum mannan antigen was positive. The patient was initially treated with broad-spectrum antibiotics (Meropenem and Vancomycin), with the subsequent addition of amikacin and caspofungin. During hospitalization, the patient developed a cephalic vein thrombosis while on anticoagulant therapy, and she was thoroughly investigated for thrombophilia. Her antithrombin III, protein C, and protein S were in the normal range, and Anti-Cardiolipin antibodies (IgG, IgM, IgA) were negative. At the same time, the genetic screening for mutations revealed no variants typical for inherited thrombophilia. The patient gradually recovered and was discharged home on April 15. On April 30, she had an episode of seizures with loss of consciousness. She was urgently admitted to the isolation unit of the neurology department of a regional hospital since she tested positive for SARS-CoV-2 again. Brain computed tomography (CT) revealed a solitary lesion with perifocal edema in the right parietal lobe. Antiedematous and anticonvulsant therapy diminished the neurological symptoms, and the patient was planned for referral to a tertiary center for further diagnostics and treatment. It was postponed as she tested positive again, and ordered home isolation. On June 15, the patient underwent brain magnetic resonance imaging (MRI). It showed a 4.6 × 4.3 × 3.9 cm multilocular lesion in the right frontoparietal region with a mass effect on the adjacent lateral ventricle . She tested positive for SARS-CoV-2 the same day and was denied admission to the neurosurgical clinic that offered no isolation ward. Instead, the patient was sent to a COVID hospital. At the time of admission, her symptoms were dry cough, stuffy nose, and mild left-sided weakness. Neurological examination showed subtle left side hemiparesis, right arm pronator drift, positive Mingazzini, and negative Romberg test. Laboratory workup revealed pancytopenia and normal tumor markers. Four days later, the neurological symptoms progressed with the development of holocranial headache, nausea, vomiting, and worsening of hemiparesis. An urgent CT of the brain was done, demonstrating enlargement of the perilesional edema with the shift of midline structures and completely effaced right lateral ventricle. A small lesion with perifocal edema was observed in the left occipital lobe. Right-sided compression of the mesencephalon suggested an imminent transtentorial uncal herniation. The patient was sent for emergency surgery on June 21 as she rapidly deteriorated with the development of a coma and right pupilar dilatation. The thick-walled multilocular abscess was found at surgery, and total excision was performed. Pus aspirated from one of the abscess collections was sent for gram staining and culture. The remaining was sent to histopathology. After the operation, the patient was transferred to the intensive care unit and started treatment with broad-spectrum antibiotics. Her postoperative laboratory was remarkable for severe thrombocytopenia, anemia, hypogammaglobulinemia, and low CD4 lymphocyte count (24/μL). Human immunodeficiency virus infection (HIV) was excluded by repeated testing. She was administered intravenous immunoglobulins (0.4 g/kg daily for 5 days). Hematoxylin-eosin staining revealed necrotizing granulomas, while the histochemical Grocott Methamine Silver staining highlighted the filamentous branching rods . Smears from cultures demonstrated gram-positive, partially acid-fast filaments, and the growth of Nocardia species. She was started on meropenem (3 × 2g) and trimethoprim/sulfamethoxazole via intravenous route while waiting for species determination and susceptibility testing. To transfer the patient to a non-COVID tertiary neurosurgical hospital, we tested her for SARS-CoV2 again, and the PCR result was positive. Final identification of Nocardia cyriacigeorgica was performed with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). The susceptibility testing showed that the agent was susceptible to trimethoprim/sulfamethoxazole (TMP/SMX), ceftriaxone, cefotaxime, imipenem, and linezolid. The test demonstrated resistance to ampicillin, amoxicillin/clavulanate, and fluoroquinolones. TPM/SMX was continued as monotherapy after 3 weeks. Neurological deficits before surgery gradually resolved, and the CT of the brain showed significant improvement. Over the next 5 weeks, the patient was tested for SARS-CoV2 seven times, and the result was always positive . The serum sample was tested for antibodies against the spike protein of the virus, and no antibodies were detected. The patient was discharged home on July 30 on an oral TPM/SMX (160/800 mg) for at least 12 months. We decided to prescribe a prolonged course of TPM/SMX because her control CD4 was still low (79/μL), and she needed to continue corticosteroid therapy (prednisone 10mg/d) for SLE. On a follow-up as an outpatient after 1 month, 3 months, and 6 months the patient was in an excellent clinical state, fully active, with no symptoms and neurological deficits. COVID-19 can be presented with a broad spectrum of clinical manifestations ranging from asymptomatic, mild, moderate, severe, to a clinical form requiring prolonged critical care ( 8 ). The early reports from Wuhan, China, demonstrated that the viral shedding in infected individuals is around 20 days, with the most extended observed duration of infectivity in survivors of 37 days ( 9 ). The study that differentiated viral dynamics in mild and severe cases of COVID-19 revealed that the mean viral load in severe cases was approximately 60 times higher ( 10 ). In contrast, the mild cases demonstrated an early viral clearance, with up to 90% of patients being tested negative on RT-PCR by day 10 ( 10 ). These studies were ground for recommendations from public health authorities in our country against routine PCR retesting after 14 days from the first positive test. Despite presenting initially with mild respiratory symptoms, our patient tested positive on RT-PCR of the nasopharyngeal swab for 233 days. An individual viral sequencing was unavailable in our country at the time of her treatment, so we couldn’t determine if she had re-infection with different strains of the SARS-CoV-2 virus. This is likely the longest PCR positivity reported in an adult patient. There is much uncertainty in the literature regarding the significance of post-symptomatic SARS-CoV-2 PCR positivity. It is unclear whether these patients carry transmission risk and whether they should be kept in self-isolation with limited access to non-urgent medical care. A study by Vibholm et al. conducted in a cohort of post-symptomatic COVID patients showed that 12.8% of patients remained PCR positive after 12 weeks following the first positive test ( 11 ). They found that the patients with the mildest disease, treated as outpatients with no limitations of daily activities, were more likely to stay persistently positive. Seroconversion did not affect viral shedding, and contact tracing revealed that persistent viral RNA detection was not associated with SARS-CoV-2 transmission ( 11 ). However, the population of immunocompromised patients was not enrolled in the study. The paper with the largest sample comparing retesting results in immunocompetent and immunocompromised patients revealed that solid organ transplant, older age, comorbidities (diabetes, obesity, and rheumatologic disease) were the risk factors for delayed SARS-CoV-2 PCR clearance, with no observed difference by the degree of immunocompromise ( 12 ). Nevertheless, several case reports demonstrated that immunocompromised individuals exhibit prolonged infectious SARS-CoV-2 shedding ( 3 ). Even more, during the prolonged course of the infection, virus evolution develops within the host with the emergence of mutations in the spike gene ( 3 , 13 ). The important concern in persistent viral RNA carriers is the potential ensuing immunosuppression and its clinical consequences ( 14 ). It was daring in this case since the patient needed to continue her immunosuppressive therapy to control the underlying SLE. Symptoms our patient experienced following acute SARS-CoV-2 infection, such as fatigue, shortness of breath, intermittent fever, and cough, resemble those described under the post-COVID-19 condition ( 15 ). It has been demonstrated that among various multiorgan symptoms of post-acute COVID-19 thromboembolic events occur in less than 5% of survivors ( 16 ). Our patient suffered several thromboembolic episodes, including massive pulmonary embolism. The last one ensued 113 days after the first positive RT-PCR test. The suspected antiphospholipid syndrome within SLE could not be confirmed since the patient didn’t meet the revised Sapporo criteria on several occasions ( 17 ). We assume that the prolonged hyperinflammatory state caused by persistent viral infection and systemic nocardiosis could have been responsible for the occurrence of thrombotic complications ( 18 ). Therefore, we prescribed acenocoumarol as an anticoagulation therapy after hospital discharge. Systemic nocardiosis superimposed on COVID-19 has been previously described in a diabetic patient ( 19 ). To our knowledge, this is the first reported case of primary cerebral nocardiosis in a patient with persistent SARS-CoV-2 infection and SLE. Systemic infection with Nocardia spp. is most commonly found in immunocompromised patients, particularly those with depressed cell-mediated immunity, including solid organ and stem cell recipients, hematological malignancies, cancer patients receiving chemotherapy, patients with human immunodeficiency virus infection, and those on long-term corticosteroid treatment ( 5 , 20 ). It has been shown in a murine model that both components of host defense contribute after the acquisition of nocardial infection ( 21 ). Neutrophils inhibit the growth of Nocardia , whereas cell-mediated immunity (CMI) is essential for the effective eradication of Nocardia in the first days following infection ( 21 ). The inhibition of CMI with Cyclosporine A and cortisone led to the formation of lung abscesses ( 21 ). Primary pulmonary nocardiosis is the most common clinical form of infection due to the mechanism of acquisition of infection by inhalation ( 22 ). Haemathologic spread may lead to the dissemination of infection to other sites, such as the skin, subcutaneous tissue, and central nervous system. Nocardial brain abscess is a severe clinical manifestation from the spectrum of central nervous system nocardiosis, with the highest mortality reaching over 35% ( 7 ). Since there is a paucity of clinical signs, no serological or biochemical markers of infection, and the radiologic imaging techniques are non-specific, awareness is fundamental for the diagnosis of nocardiosis ( 23 , 24 ). Radiological features of solitary or multifocal ring-enhancing lesions are commonly misdiagnosed as brain metastases, tuberculosis, or bacterial abscess of other etiology ( 25 ). Our patient with a nocardial brain abscess presented with overt immunosuppression. It has been shown that corticosteroid therapy represents the most important risk factor for the development of nocardial infection ( 26 ). However, the impact of persistent infection with SARS-CoV-2 on further immunosuppression can’t be neglected. It has been previously demonstrated that due to the down-regulation of various proteins associated with immune function, the immune system is suppressed early during COVID-19 ( 27 ). A robust CD4 T-cell response is crucial for the appropriate control of the disease ( 27 ). An extremely low CD4 count in our patient may explain an ineffective clearance of SARS-CoV-2, and failure to protect against the opportunistic infection with Nocardia . Although nocardial brain abscess is commonly secondary to the primary pulmonary site of infection, we couldn’t identify the primary focus in our patient despite a thorough investigation. We assume that the primary infection was subclinical, overshadowed by the CT feature of COVID-19 pneumonia, and masked by a short course of antibiotics that the patient received during the previous hospitalization ( 28 ). Diagnosis and treatment of nocardial brain abscesses continue to be challenging. Due to the rarity of this clinical entity, no strict recommendations exist. Still, it seems that a more aggressive surgical approach with total excision of the lesion rather than aspiration warrants more promising outcomes ( 29 , 30 ). Antimicrobial treatment should start with intravenous administration of at least two agents that represent the first-line therapy and includes TMP/SMX ( 31 ). Susceptibility testing is essential due to various resistance patterns, particularly with Nocardia farcinica . A recent study has shown a high sensitivity rate of Nocardia isolates to TMP/SMX (96.3%), amikacin (92.6%), and linezolid (100%). In contrast, the resistance rates were high to ceftazidime (69.3%), cefepime (64.5%), and amoxicillin/clavulanic acid (92.5%) ( 32 ). After a minimum of 3 weeks of intravenous therapy, patients can be switched to oral treatment. For patients with nocardiosis of the central nervous system, treatment should be continued for at least 12 months and even longer in immunocompromised patients who must be maintained on immunosuppressive therapy ( 24 ). We presented the case of an immunocompromised patient with COVID-19 and a persistent SARS-CoV-2 PCR positivity who developed a nocardial brain abscess during the course of the disease. Opportunistic central nervous system infections should be considered in the differential diagnosis of brain lesions in patients with immunosuppression. The inability to clear the virus in these patients may be a particularly important sign of suppressed immune systems. We believe that the good outcome in our patient was due to her young age, an aggressive surgical treatment followed by an adequate antimicrobial and other supportive therapy.
|
Study
|
biomedical
|
en
| 0.999998
|
PMC9478274
|
Intentional or accidental barium ingestion is extremely rare, but it can cause death when the patient is not rescued timely, as reported on several occasions. Recently, a suicidal ingestion of barium chloride solution occurred in a medical facility and the patient was rescued successfully. We present the data for this case; for the first time, we measured the concentration of barium in 9 groups of paired serum and urine samples collected sequentially after ingestion, and revealed that barium can be metabolized rapidly during the first 24 hours. Upon arriving at the emergency department of the local hospital about 2 hours after the suicidal ingestion, the patient was presented with somnolence, the pulse rate declined to 67 beats per minute, his blood pressure rose to 158/92 mm Hg, but he did not exhibit nausea or vomiting. The blood concentration of potassium was 2.74 mmol/L. Since the case was reported as barium poisoning, the patient received gastric lavage by magnesium sulfate solution, intravenous sodium thiosulfate, and potassium supplementation. Subsequently, the patient was transferred to ICU for further treatment. About 3 hours after the ingestion, the blood concentration of potassium dropped to 1.5 mmol/L. To accelerate the elimination of barium from the blood, blood dialysis was performed with sodium bicarbonate. About 0.5 hours after the start of blood dialysis, the blood concentration of potassium raised to 2.2 mmol/L. About 2.5 hours later, the blood dialysis was stopped. After continuous intravenous sodium thiosulfate and potassium supplementation for about 8 hours, the blood concentration of potassium returned to normal. In order to clarify the pathogenesis mechanism, a group of paired samples, which contained 1 serum sample and 1 urine sample of the patient collected simultaneously, were sent to the local municipal center for disease control and prevention for barium analysis. The measurement was performed using an ICP-MS instrument (NexION 350D, Perkin Elmer, Waltham, MA, USA). It turned out that the concentration of barium in the serum and the urine was 4.3 mg/L and 3.9 mg/L, respectively. This group of paired samples were collected at about 9.5 hours after ingestion. Compared with serum and urine samples from the common population measured simultaneously (with both consistently below 0.01 mg/L), these values were considered extremely high. Meanwhile, the high concentration of barium in the urine was also good news indicating that barium was undergoing rapid metabolism. The high concentration of barium in the serum and urine sample of the patient helped clarify the pathogenesis of barium poisoning, and the treatment of the patient was assured. For further observations on the metabolism of barium in the human body, we measured the concentration of barium in another 8 groups of paired serum and urine samples collected sequentially from the patient . The concentration of blood potassium returned back to normal about 14 hours after the ingestion. At this time point, the concentration of barium of the second group of paired serum and urine sample was 1.2 mg/L and 2.9 mg/L, respectively. In the third group of paired samples, collected about 21 hours after ingestion, the concentration of barium in the serum had dropped to 0.59 mg/L and to 1.9 mg/L in the urine sample, which were still high compared with the common population. It was clear that the concentration of barium in the serum had decreased rapidly in the first 24 hours. Although the patient received blood dialysis, the high level of barium in the urine meant that barium in the blood was also being metabolized rapidly by the kidney. About 100 hours after the ingestion, the concentration of barium in the serum was <0.1 mg/L, while it was still 0.27 mg/L in the urine. Although it was a little higher than the concentration in the common population, the patient exhibited only slight acute symptoms. About 1 week later, the concentration of barium both in the serum and the urine was <0.05 mg/L, and the patient was recovered. From these results, we could infer that (1) it is the blood barium that causes the clinical symptoms, and the key to rescue the patient is to decrease this level, in addition to potassium supplementation; (2) the high level of barium in the urine is the result of the rapid metabolism of barium, and this high level may decline slower than that in the blood; (3) about 1.2 mg/L of barium in the blood may not cause hypokalemia. As for emergency medical treatment, potassium supplementation and blood dialysis as well as gastric lavage are effective measures. Acute barium poisoning has not been frequently reported, with a few cases in recent years. Since the first case of acute barium poisoning was published in 1984, hypokalemia has been accepted as the most profound symptom. In subsequent reports, potassium supplementation was recommended as essential treatment and the patients were rescued successfully. In addition, hemodialysis was used to promote clinical improvement. In the present case, potassium supplementation and hemodialysis were administered simultaneously, and the patient was rescued despite the severe hypokalemia (K + 1.5 mmol/L), which was near the lowest concentration ever reported. This highlights the utility of hemodialysis in the treatment of severe barium poisoning. To the best of our knowledge, the current study is the first of its kind to report on the metabolism of barium in the human body. The results from 9 groups of paired serum and urine samples collected from the patient showed the rapid metabolism of barium in blood during the first 24 hours. This result was consistent with an earlier report, which simply mentioned that barium had disappeared from the patient’s blood within 24 hours after ingestion but provided no detailed data. Our results suggest that, in the first 24 hours after ingestion, prompt and massive potassium supplementation and other symptomatic treatments should be implemented. Treating the patient with hemodialysis may help facilitate the decrease of barium concentration in the blood.
|
Study
|
biomedical
|
en
| 0.999999
|
PMC9542376
|
1:46 Key surgical steps include extensive condylectomy with dissection of the vertebral artery from the sulcus arteriosus to the dural ring. This was needed to gain access to the anterior medulla. Dentate ligaments were cut, also giving good access to the V 4 segment. A large feeder from the left V 4 vertebral artery was divided. A large feeder from the right anterior spinal artery was divided. The AVM was circumferentially dissected and removed, and IC green video angiography confirmed a complete resection.
|
Other
|
biomedical
|
en
| 0.999998
|
PMC9592235
|
Telescopic dentures utilizing natural dentition has multiple advantages, such as preservation of the alveolar process, provision of better load transmission, maintenance of sensory feedback, and provision of cross arch stabilization . Furthermore, telescopic removable prostheses provide good retention and stabilization, secondary splinting action, directing the occlusal forces along the long axes of the abutments, establish a common path of insertion, and ease of repair and adjustment when an abutment is lost . The telescopic attachment also allows better accessibility to the abutments and the gingiva allowing an effective home care to maintain good oral hygiene . Studies have reported good patient satisfaction rates and better esthetics with telescopic dentures compared to conventional prostheses . Hence, telescopic prostheses can be used as a modality treatment option for restoring the partially edentulous patients, in which it enhances the maintenance and survival of natural abutments. On the contrary, the telescopic prostheses fabrication is clinically and laboratory demanding procedure and costly, with high rates of technical failures, such as de-cementation, fracture of the artificial teeth, metal framework or the denture base, and periodic follow-up . A 55-year-old female patient was referred to Prosthodontic Department of Hamdan Bin Mohamed College of Dental Medicine for her inability to chew. After obtaining her medical, dental, and social histories, she was examined clinically and radiographically . It was determined that she had lost her teeth due to dental caries and periodontal diseases. Intra oral examination revealed multiple carious lesions (FDI 11, 13, 34, 44, and 45) and (FDI 21 and 24) were remaining roots while (FDI 11, 13, and 45) responded negatively to the pulp sensibility tests hence were diagnosed as necrotic. Periodontal assessment revealed absences of deep pockets and absences of mobility and recession of 5 mm buccally (FDI 16), 2 mm recession labial to (FDI 34), 3 mm recession labial to (FDI 33), and 4 mm recession labial to (FDI 41). Upper and lower impressions were recorded using irreversible hydrocolloid as a study model. A facebow record was taken, and casts were articulated and mounted in centric relation position on a semi-adjustable articulator (Artex Articulator). Carious teeth (FDI 34 and 44) were restored using composite restoration, while root canal treatment was done for necrotic teeth (FDI 13, 12, and 45), and extraction of the renaming roots (FDI 21, and 24) was done. The plan is to restore the missing teeth using maxillary telescopic complete denture and mandibular conventional chrome cobalt removable partial denture. Root canal treatment was done on the necrotic teeth (FDI 13 and 11), and later was restored using fiber post and composite build up. Crown preparation was done on the abutment teeth on tooth (FDI 16, 13, 11, and 26) to serve as primary coping . Final impression for (FDI 16, 13, 11, and 26) was taken using special tray to provide even thickness of impression material and minimize tissue displacement and dimensional changes of the impression material. Primary semi-precious metal copings were fabricated for (FDI 16, 13, 11, and 26); they were tried in the patient mouth to confirm the setting of the primary copings . Finfishing and polishing is aproceduer in the labratory done to make the primary coping to be smooth and polished. Primary coping and metal framework then were tried in the patient mouth to check for the passive fitting, and again, overall impression was taken utilizing the functional border molding technique . The next step is to fabricate occlusal wax bite rim to the jaw relationship records. Cingulum rest on (FDI 33 and 43) and mesial occlusal rest on (FDI 34) were prepared on the teeth. Lower impression was taken for fabrication of metal framework of lower chrome cobalt removable partial denture . Impressions were poured in the laboratory to fabricate the refractory cast with wax up of the chrome cobalt framework . Try-in the metal framework in the patient's mouth . A special tray on the distal free end saddle was fabricated, and impression was taken using border molding technique and monophase impression material (Figures 18(a) and 18(b) ); then, altered cast technique was used for the free end saddle area to preserve the residual ridges, improve stress distribution, decrease food impaction, and decrease torqueing of abutment teeth. Old cast was sectioned on the distal end, and the new impression was reattached, as shown in Figures 19(a) and 19(b) . Beading and boxing the cast was done, and stone was poured as shown in Figure 20 , while Figure 21 shows the cast after the altered cast technique is done. Then, the framework was tried on the cast and was noticed that there is a space between the metal framework and the cast on the free end saddle area as shown in Figure 22 . The permanent cementation protocol for the primary copings was done one by one, while the superstructure was seated each time over all copings to ensure passive fitting. To avoid excess cement overflow, index of the intaglio surface of the primary coping was made using silicon bite registration material . The primary coping was loaded with the cement, and then, the index was placed to remove the excess cement and then was inserted on the tooth and light cured according to the manufacturer instruction. Upper telescopic complete denture and lower chrome cobalt removable partial prostheiss was delivered (Figures 26(a) – 26(f) ). Oral hygiene instructions and a three-month recall appointment were suggested. Treatment modalities for partially edentulous patients range from removable prosthesis, fixed prosthesis, implant supported removable prosthesis, or implant supported fixed prosthesis. Clinical decision is based on the status of the abutment, periodontium, bone availability, and patient medical health and presences. Nowadays, dental implants have been popular treatment option for replacing missing teeth due to its high survival rates. The literature has reported high survival rate for implants. Zembic et al. have reported that a survival rate for single implant in 5 years was 97.6% with minimal biological and technical complications . Muddugangadhar et al. reported that survival rate of implant tooth supported prostheses was 94.525% after 5 years in function . In addition, the survival rate of implant supported removable partial dentures with distal extension was reported to be 91–100% with marginal bone loss ranging from 0.3 to 2.30 mm . Survival rate of telescopic retained removable prostheses in severely reduced dentition was 93.9% for abutment teeth and 87.5% for telescopes , whereas another study compared the survival rate between the telescopic removable prostheses and the conventional removable prostheses (clasp retained) and found no statistical difference . However, crown decementation was significantly higher among the telescopic removable prosthesis 76.9% compared to conventional ones 28.3% . A Longitudinal follow-up study of 5–10 years showed that telescopic prostheses has lower failure rate compared to clasp retained partial removable prosthesis . In our case, the abutment teeth for the telescopic retainers if in future they were lost or extracted, the denture could still function without compromising the occlusion and aesthetic. Arnold et al. found that telescopic crowns with additional retentive elements had the highest retention forces . Others found that using telescopic removable prostheses had improved the oral-health-related quality of life of patients .
|
Other
|
biomedical
|
en
| 0.999998
|
PMC9600881
|
The possible sources of FG involve the gastrointestinal tract (30–50%), including perianal abscesses, anal fissures, anal fistula, and colonic perforations and the genitourinary tract (20–40%), such as bulbourethral gland infection, urethral injury, epididymitis, orchitis or lower urinary tract infection, and cutaneous injuries (20%) due to hidradenitis suppurativa, scrotal pressure ulcer, and trauma. The presence of foreign bodies may also lead to the disease. Some conditions that depress the cellular immunity may predispose a patient to the development of Fournier gangrene. The high-risk factors include the following: diabetes mellitus, morbid obesity, alcoholism, immunosuppression, chemotherapy, or chronic corticosteroid use . The presence of comorbidities, such as diabetes mellitus, heart disease, renal failure, and kidney diseases, was described as associated with an increased risk of mortality . Because of the life-threatening condition, it requires quick and accurate diagnosis. Several different scores, such as the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC), Fournier Gangrene Severity Index (FGSI), and Uludag Fournier Gangrene Severity Index (UFGSI), were established to predict the risk of FG, the severity of the disease, and the outcome . The diagnosis is usually made clinically, but radiological imaging—ultrasound (US), computed tomography (CT), magnetic resonance imaging (MRI)—can be very useful in clinically ambiguous and complex cases . CT is a modality of choice in diagnostic imaging of FG, but there are cases where MRI should be preferred, especially in cases of FG combined with perianal fistula and abscess, because of its higher soft-tissue resolution and detailed assessment of the disease’s extent. US can be considered in the cases of patients who cannot be transported for CT/MRI scanning . Therapy involves administration of broad-spectrum antibiotics and aggressive surgical debridement of necrotic tissues . Several new promising therapies, such as hyperbaric oxygenation (HBO), vacuum-assisted wound closure (VAC), and maggot therapy (blowfly larvae), were also reported . MRI was performed with a 1.5-T machine GE Signa, HDxt, General Electric Medical Systems with an 8-channel body coil. The following images were obtained: T2-weighted FRFSE images without fat saturation and with fat saturation ; T1-weighted FSE images without the contrast agent (TR 660 ms, TE 9,3 ms, 5-mm slice thickness, 1.0-mm gap) and then after injecting 20 mL of gadodiamide (Omniscan) in the dynamic LAVA gradient echo pulse sequence (TR 4,2 ms, TE 2.0 ms, 4.4-mm slice thickness with 2.2-mm overlap) as well as T1-weighted FSE with FAT SAT . Vital signs (blood pressure, heart rate, respiration rate) were stable. A physical examination revealed erythema and induration in the area of the sacral region, indicating a perianal abscess, along with hemorrhoids in the rectal examination. Laboratory results revealed leukocytosis (23.650/μL) with neutrophilia (19.830/μL, 83%) and an elevated C-reactive protein level (173.8 mg/dL). Biochemical parameters, such as serum creatinine, sodium, potassium, bicarbonate, and glucose, along with hemoglobin and hematocrit, were within the reference range. On admission, a perianal abscess incision and drainage were performed. To assess the extent of the disease, magnetic resonance imaging (MRI) was performed. MRI revealed a break in the continuity of the skin on the left side of the posterior anal wall with a width of 5 mm and high signal intensity on T2-weighted FSE sequences, 35 mm from the anal sphincter. It connected the anal canal with perianal fluid collection adjacent to the posterior anal wall with dimensions of approximately 15 × 20 × 20 mm . Two blisters, with fluids spread along the lateral anal walls with a diameter of 5–10 mm on the right side and 10–15 mm on the left side, converged on the anterior wall . An abnormal signal intensity extended downwards to the buttocks on both sides of the anus , but only the left side showed inflammatory infiltration with numerous gas foci in the area of 60 mm and extending to the perineum . After the MRI scan and diagnosis of transsphincteric perianal fistula, perianal abscess, and Fournier’s gangrene, the patient was taken up for an emergency scrotal andperianal debridement followed by a left orchiectomy with bilateral drainage of the perianal area . The patient had dual intravenous antibiotic therapy (vancomycin—1g twice daily, piperacillin/tazobactam—4,5g four times daily) until the positive culture results were obtained. The microbiological culture revealed Escherichia coli, Enterococcus faecalis, and Bacteroides stercoris sensitive to piperacillin/tazobactam. The piperacillin/tazobactam antibiotic was continued. Wound dressing was performed every second day and reconstructed by secondary suturing on the 20th postoperative day with a good cosmetic outcome . The patient was discharged home 23 days after presentation with an excellent prognosis. A unique form and extension of fluid collections as a 3D model was designed and visualized using previously described software 3D Slicer v4.8.1 software and was based on the MRI scan ( Video S1 ). Fournier gangrene, a rapidly progressing disease with a potentially fatal outcome, requires increased attention in the diagnostic approach. Due to many possible sources of infection, it may have various clinical presentations, including an indolent course that may hinder the final diagnosis . The intensity of the symptoms may be inadequate to physical findings, which indicate the importance of radiological imaging in early diagnosis, assessment of the extension of the disease, and rapid induction of effective treatment . In our case, a clinical examination showed an abscess in the perianal area with increased inflammation markers but without any further symptoms or abnormal laboratory findings. After the initial incision and drainage of the perianal abscess, an MRI was performed to broaden the diagnosis. It revealed a massive spread of fluid collections and Fournier gangrene of the gluteal muscles as well as the perineal and scrotal area. More aggressive therapy was administered and resulted in a successful outcome. CT and US are usually the methods of choice performed with FG as they are widely available and serve as effective tools for the detection of soft tissue thickening or gas . However, MRI remains superior to US and CT as it provides a higher soft tissue contrast, a more detailed evaluation of the disease’s extent, and the initial site of infection . It may be even required if findings from other imaging modalities remain indecisive . Detailed imaging, especially at the early stages of the disease with no or sparse symptoms, facilitates diagnosis and adequate surgical debridement, which may improve the outcome, prevent severe complications, and hinder a recurrence .
|
Other
|
biomedical
|
en
| 0.999996
|
PMC9601649
|
A single, 3-year-old, male neutered CKCS dog originating in the United Kingdom was investigated. Both parents were reportedly healthy, the health status of siblings was unknown. The dog was presented to the Small Animal Hospital of the University of Glasgow for investigations of suspected focal seizures. Blood was taken for hematology and serum biochemistry. Magnetic resonance imaging (MRI) of the brain was performed with a 1.5 Tesla machine (1.5T Magnetom, Siemens, Erlangen, Germany and included T2-weighted sagittal, dorsal and transverse views and the following transverse view: fluid attenuated inversion recovery (FLAIR), Gradient echo (t2*), T1-weighted pre- and post-contrast sequences (gadopentate dimeglumine; Magnevist, Bayer Schering Pharma AG, Berlin, Germany). A cerebrospinal fluid sample was taken for total and differential cell counts, and protein levels. Finally, urine was submitted for organic acid analysis and blood for acylcarnitine levels to an external human laboratory. A control sample of a clinically healthy dog was sent to compare the acylcarnitine levels, as there are no published reference ranges for dogs. An Illumina TruSeq PCR-free DNA library with ~413 bp insert size of the affected dog was prepared. We collected 280 million 2 × 150 bp paired-end reads corresponding to 30.9 × coverage on a NovaSeq 6000 instrument (Illumina, San Diego, CA, USA). Mapping to the UU_Cfam_GSD_1.0 reference genome assembly was performed as described . The sequence data were deposited under the study accession PRJEB16012 and the sample accession SAMEA10644719 at the European Nucleotide Archive. Genome sequence data of 923 control dogs of diverse breeds were also included in the analysis ( Table S1 ). Primers 5′-GAG TAA AGG CCA GTT CTT TGG A-3′ (Primer F) and 5′-CCT GGT AAC CCA GAA ACA TCA-3′ (Primer R) were used for the generation of an amplicon containing the ACADM :c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG variant. PCR products were amplified from genomic DNA using AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Reinach, Switzerland). Product sizes were analyzed on a 5200 Fragment Analyzer (Agilent, Basel, Switzerland). Direct Sanger sequencing of the PCR amplicons on an ABI 3730 DNA Analyzer (Thermo Fisher Scientific, Reinach, Switzerland) was performed after treatment with exonuclease I and alkaline phosphatase. Sanger sequences were analyzed using the Sequencher 5.1 software (Gene Codes, Ann Arbor, MI, USA). Five animals (3 females and 2 males) were included in each genotype group (homozygous wildtype, heterozygous, homozygous mutant). The initially investigated clinical case was included in the homozygous variant group. All animals were adult (between 2.7 and 9.9 years of age). Whole blood samples of the animals were stored at −20 °C until analysis. Acylcarnitines were analyzed with modification of a previously published protocol . In short, 20 μL of hemolyzed whole blood, 20 µL acetonitrile (ACN), and 360 µL of water containing deuterated acylcarnitines internal standards were pipetted into an Eppendorf tube. The tubes were vortexed, set 5 min into an ultrasound bath and centrifuged at 12,000× g . Next, 20 µL of the clear supernatant was transferred into a HPLC vial containing 180 µL of ACN. Then, 2 µL was injected into the liquid chromatography mass spectrometer (HPLC-MS/MS, Waters Xevo TQ-S with Acquity I-Class 2D UPLC). The HPLC was mounted with an ACQUITY UPLC BEH Amide column (2.1 × 100 mm, 1.8 µm, Waters), the eluents were A (water:ACN (1:1) 10 mM ammonium formate with 0.15% formic acid) and B (water:ACN (5:95) 10 mM ammonium formate with 0.15% formic acid acetonitrile) at a flow rate of 0.4 mL/min. The gradient was: 100% B until 1.5 min, 74% B at 6 min, 22% B at 8 until 10 min then back to 100% B. Total run time was 15 min. The acylcarnitines were analyzed with positive electrospray ionization using multiple reaction monitoring (MRM) ion scan mode. Absolute quantification was achieved with a 6-point calibration curve. A male neutered CKCS, born out of reportedly healthy parents, was presented at the age of 1.5 years, with an acute history of suspected complex focal seizures including prolonged lethargy, being less responsive and proprioceptive ataxia. These episodes initially occurred several times a week, lasting from 20 min to multiple hours during which the dog was mainly lethargic. General physical examination and neurological examination were normal. Complete blood count and serum biochemistry profile were within normal limits. MRI imaging of the brain revealed breed-related changes including occipital malformation with mild cerebellar herniation, medullary kinking and syringohydromyelia, consistent with canine Chiari-like malformation and syringomyelia (CMSM). No other abnormalities of the brain were detected. The results of the cerebrospinal fluid (CSF) analysis collected at the cerebellomedullary cistern showed mild albuminocytological dissociation (total nucleated cell count: 0 cells/µL, RI < 5 cells/µL; protein concentration 40 mg/dL, RI < 25 mg/dL). The dog was prescribed 40 mg/kg levetiracetam three times a day, however this resulted in severe sedation. The levetiracetam dose was therefore lowered to 25 mg/kg three times a day and 3 m/kg phenobarbital twice a day was started, which resulted in a partial response as the seizures decreased in frequency and intensity. The patient remained stable for 3 months before the seizure interval increased again and particularly the lethargy remained present up to 24 h. The dog would return to normal the following morning. An increase in the phenobarbital dose was not accompanied by an improvement. Given the unusual presentation, urine was analyzed for organic acids and revealed significant excretion of hexanoylglycine and a peak of suberic acid, highly suggestive of a fatty acid β-oxidation disorder. A follow-up test consisted of blood spot acylcarnitine analysis and revealed an increase in C6, C8 and C10:1 acylcarnitines, as judged against human adult reference intervals and a clinically normal dog ( Table S2 ). Extrapolating from human patients, and in comparison with the control dog, the acylcarnitine profile was consistent with a diagnosis of medium-chain acyl-CoA dehydrogenase deficiency. In addition to 25 mg/kg levetiracetam three times a day and 3.75 mg/kg phenobarbital twice a day, the dog was prescribed a low-fat diet and a midnight snack consisting of carbohydrates. Prolonged periods of fasting and formulas that contained medium-chain triglycerides as primary source of fat were also advised to avoid. This management protocol correlated with a complete resolution of clinical signs for the following 6 months. The anticonvulsant medication was therefore reduced to subtherapeutic levels. However, this was reversed as the dose reduction resulted in an increase in seizure frequency. The blood spot acylcarnitines were repeated to test sufficient free carnitine levels and these were found within normal limits ( Table S2 ). At the time of writing, the dog has been stable for 9 months on 25 mg/kg levetiracetam three times a day, 3 mg/kg phenobarbital twice a day and a low-fat diet, with no further major seizures and a repeated normal neurological examination. The automated analysis identified three closely spaced homozygous private protein-changing variants in ACADM . Visual inspection of the short read alignments in the region revealed that these three initially separately called variants actually represented just one single insertion-deletion variant. This variant, XM_038541645.1:c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG, leads to a frameshift and is predicted to truncate 267 codons or roughly 63% of the wild type MCAD open reading frame, XP_038397573.1:p.(Thr150Ilefs*6). On the genomic level, the variant can be designated as Chr6:71,401,388_71,401,389delinsCATAATTCTTAGACAATATTGAGAATTAAC . To confirm the functional impact of the ACADM variant on fatty acid metabolism, acylcarnitines were measured in five dogs of each genotype ( Table S2 ). Biomarkers of MCAD deficiency, C8- and C10:1-carnitines were elevated in all homozygous dogs compared to the five WT dogs. The specific C8/C10 and C8/C12 ratios used for diagnosing MCAD deficiency in humans were elevated 1.3 and 2.9-fold in heterozygous dogs, respectively and 11 and 65-fold in homozygous variant dogs, respectively as compared to wild type dogs . In this study, we identified a homozygous ACADM frameshift variant in a CKCS with a history of complex focal seizures including lethargy and highly elevated MCFA metabolites in blood and urine metabolic testing. The clinical phenotype of the affected CKCS resembled human patients with MCAD deficiency and variants in the human ACADM gene . The investigated dog also showed striking clinical and biochemical similarities to a previously described CKCS with aciduria and elevated levels of urine hexanoylglycine and plasma acylcarnitines . The plasma acylcarnitine C8/C12 ratio in the previously investigated case was at 28, which is comparable to the ratios found in the homozygous mutant dogs of our study (range 20–52, median 28). Typical pathological C8/C10 and C8/C12 ratios in human newborns range between 1.6–18 and 4.4–449, respectively . In humans, the acylcarnitine biomarkers and ratios remain elevated even between decompensation episodes and under appropriate treatment (carnitine supplementation; avoiding prolonged fasting and lipolysis) . Somewhat unexpectedly, the mutant allele was quite common in a representative population of CKCS that were examined for the presence of syringomyelia in a Swiss/German screening program. The CKCS breed is genetically predisposed for the occurrence of Chiari-like malformation and syringomyelia, which may result in phantom scratching, pain, and neurological deficits such as scoliosis, weakness and proprioceptive impairment . An association between Chiari-like malformation and epileptic seizures was hypothesized , but could not be confirmed in an experimental investigation . The identified ACADM variant now provides a compelling new candidate variant, which might be responsible for a part of the seizure phenotypes that are observed in the CKCS breed. Clinical signs due to Chiari-like malformation and/or syringomyelia and MCAD deficiency are partially overlapping and may be very difficult to disentangle in a clinical setting. The most objective way of differentiating epileptiform seizures would be by recording the electrical activity of the brain using electroencephalography, but this is technically impractical for several reasons in veterinary settings . Further prospective studies are needed to better differentiate between those diseases in CKCS and to evaluate the clinical impact of the observed enzyme deficiency in some dogs of this breed. MCAD deficiency in dogs seemingly does not clinically manifest as severe as in humans. However, our data show a clear increase in MCFAs in ACADM homozygous mutant dogs. This might point to an additional compensatory mechanism in the dog, which prevents or dampens the manifestation of clinical consequences of elevated MCFAs. In humans, phenotypic diversity ranging from sudden neonatal death to asymptomatic status has previously been reported. Human patients with complete loss of MCAD activity can also remain asymptomatic, suggesting that additional genetic or environmental factors may play a role in the phenotypic diversity . Additional genetic or environmental factors are also likely to modulate the phenotype in MCAD deficient dogs. The improvement of clinical signs upon changing to a low-fat diet in our index case indicates that the diet has a major influence on the clinical phenotype. At this time, we cannot exclude the possibility that additional genetic factors also modified the clinical phenotype. While our data conclusively demonstrate that the ACADM frameshift variant causes MCAD deficiency and the biochemical alterations in the lipid metabolism, it is not yet fully clear whether the MCAD deficiency alone is responsible for the clinical phenotype or whether additional environmental and/or genetic risk factors are required for the expression of clinical signs. The identification of the ACADM frameshift variant enables genetic testing for MCAD deficiency and will facilitate future prospective studies to clarify this important question. In humans, newborn screening programs are now well established, but prior to this, the majority of human MCAD deficiency cases presented at young age (before 2 years) . No newborn screenings are performed in dogs, and it is currently unknown if MCAD deficiency could have an impact in CKCS neonatal mortality. Previous studies have reported a high percentage of perinatal mortality in CKCS as is the case for many purebred dogs . We did not observe a significant deviation from Hardy–Weinberg equilibrium in our cohort of 162 dogs. Hence, a possible influence of the ACADM variant on neonatal mortality in the breed is presumably low. Nonetheless, further prospective studies might be considered to investigate if MCAD deficiency plays a role in CKCS neonatal mortality. We identified a dog with MCAD deficiency that clinically, biochemically and genetically resembled human patients with variants in the ACADM gene. The putative disease allele was common in a representative CKCS cohort and might contribute to seizure phenotypes that are observed in the breed. Our data enable genetic testing to establish a diagnosis in dogs with suspected MCAD deficiency and to prevent the unintentional breeding of further dogs with MCAD deficiency. Further prospective studies are needed to assess the clinical consequences of MCAD deficiency in the CKCS breed.
|
Other
|
biomedical
|
en
| 0.999997
|
PMC9660011
|
In an ever-growing multicultural society, cultural competency and sensitivity are necessities for EOLC but can be easily compromised by the care teams’ lack of knowledge or hospital system-related barriers, the latter referring to facilities lacking amenities for cultural diversity and favoring a universal approach to EOLC. Barriers within the hospital system place a limit on materials and personnel, preventing the facility's ability to adjust patient care in their approach to death and dying . For places such as the intensive care unit (ICU), many accommodations cannot be met due to logistics and acuity of patient care, and often lead to undesired outcomes and interactions. Arguably, limitations on EOLC violate the notion of non-maleficence and beneficence due to the inability of healthcare providers to care for the emotional and spiritual wellbeing of their patients. This ethical dissonance calls attention to the difficulty that the healthcare team in the ICU must face in providing holistic and quality care to their patients as well as highlights the need for our healthcare systems to account for cultural, religious, and spiritual diversity. We present a case where the routine functioning of the health system was modified to accommodate the religious and cultural practices of the patient and the family. A 57-year-old male was brought to the emergency department (ED) after an out-of-hospital cardiac arrest. The family found him unresponsive on his bed; he was last seen normal about an hour ago. Bystander cardiopulmonary resuscitation (CPR) was done by the family for about 10 minutes before the paramedics arrived. The patient had a return of spontaneous circulation at the time of the paramedics’ arrival. En route to the hospital, the patient had repeated episodes of cardiac arrest, with a cumulative estimated arrest time of 25 minutes. The patient had a history of primary head and neck cancer (status post partial glossectomy and lymph node dissection, followed by chemoradiation), followed by metastatic recurrence, for which he was on immunotherapy. Past medical history was also significant for type II diabetes mellitus, hypertension, hepatitis C, coronary artery disease, unilateral below-knee amputation, renal cell carcinoma (status post partial nephrectomy), and dysphagia. The patient was admitted to the ICU and treated with targeted temperature management (TTM), broad-spectrum antibiotics, and mechanical ventilatory support. Over the hospital course, the patient had poor neurological recovery and went into status epilepticus after rewarming and cessation of sedation. Aggressive management of seizures was done. Family meetings were held for goals of care discussion based on poor neurological prognosis in a patient with multiple medical problems. The family decided to proceed with transition to comfort-focused care.
|
Other
|
biomedical
|
en
| 0.999997
|
PMC9751594
|
The situation of people with dementia in hospital is frequently complicated by other related conditions, which may present similarly, yet necessitate a different or more comprehensive treatment approach. A cardinal example is delirium, which is common following surgery ( 5 ), and can be aggravated by inadequate medication ( 1 ). Delirium typically results in prolonged length of inpatient stay and a short-term 20-fold increase in mortality. A quarter of older patients with delirium die within 3 to 4 months, and 41% of previously self-caring individuals require discharge to a nursing facility. Symptoms are fully reversible in ~50% of cases ( 6 ), but recovery may depend on timely recognition and initiation of appropriate treatment. Another challenge in the care of the elderly, and especially patients with dementia, is the frequent polypharmacy, which refers to the use of four to five or even more medications at the same time. Even in the absence of obvious side-effects, polypharmacy must be regarded as a risk factor for the occurrence of complications like delirium or behavioral disorders. Such complications can arise because numerous pharmaceuticals, for example loop diuretics ( 7 ) or digitalis glycosides ( 8 ), are generally capable of triggering delirium in predisposed patients. Furthermore, psychotropic medications frequently used for behavioral disorders may themselves induce considerable somatic and psychiatric side-effects ( 6 ). Several approaches have been proposed to improve the care for patients with dementia and to prevent delirium in acute care hospitals. Interventions to improve care in general include patient-centered care provided by hospital staff ( 9 ) or the training of volunteers ( 3 ). To specifically reduce the incidence of delirium, both non-pharmacological ( 10 ) and pharmacological ( 11 ) interventions show moderate effectiveness, but there is considerable variability concerning the benefit for the individual patient. While these approaches are promising and are currently being further developed, their applicability may be particularly challenging in smaller, rural hospitals: In addition to the increasing average age of the population, younger individuals frequently concentrate in larger cities, leaving small towns and rural areas predominantly affected by the consequences of having an aging population ( 12 ). This trend leads to a disproportionately increasing number of patients with dementia in rural hospitals, and at the same time, contributes to the lack of qualified staff to support specialized units for dementia treatment and care, such as neurology or (geriatric) psychiatry departments ( 13 , 14 ). Here we propose and evaluate the feasibility of an out-reach consultation service provided by a specialized institution within rural surroundings to alleviate this problem. A central aspect of the current study was the evaluation of the questions raised by the partner institutions when requesting our consultation service for an individual patient. The circumstances leading to initiation of the consultations were also considered. Since the wording of questions arising under comparable circumstances varied, we performed a content analysis using inductive categorization to enable quantitative analyses ( 16 ). As consultation forms were primarily completed to meet the needs of the referring clinicians, the categories were defined according to the existing content. For example, the category Suspected Dementia included questions regarding dementia, memory impairment, and cognitive decline, whereas questions concerning confusion and disorientation were also assigned to the category Suspected Delirium . Furthermore, questions relating to drug intolerance and to recommendations on pharmacotherapy were included in a single category ( Pharmacological Issues ): referring clinicians typically requested advice regarding a potential change or discontinuation of medication in both areas. The conditions leading to acute admission to the partner hospitals were categorized according to the relevant medical specialty or the specific reason for admission. In absolute numbers, the most common reasons for patients' admission to the partner hospitals were problems classified under Surgery , with falls being the most frequently reported event leading to admission ( N = 15, 24.6%). Other common reasons were categorized under Internal Medicine, Neurology or Psychiatry, and planned adaptation or modification of pharmacotherapy. The latter arose particularly at the partner hospital specializing in the treatment of diabetes. Notably, in 17 cases (27.9%), the primary reasons for admission to the partner hospitals were neuropsychiatric problems, although the partner hospitals had neither neurology nor psychiatry departments. Beyond dementia and cognitive dysfunction, 38 patients (64.4%) had a history of at least three chronic medical conditions, and 23 (39.0%) had six or more diagnoses of a chronic disease. Considering the importance of delirium in the differential diagnosis for dementia and as a risk factor for morbidity and mortality in older adults ( 6 ), risk factors for developing delirium were specifically explored. Acute or chronic pain, hearing or visual impairment, recent surgical procedures, and infections were noted most frequently . Mirroring the focus of the consultation requests on suspected dementia, the group of dementias (ICD-10: F00–F03) constituted the diagnoses made most frequently by the physicians performing the consultations . Further diagnoses typically associated with cognitive symptoms included delirium (ICD-10: F05.x, F1x.4) and mild cognitive impairment (MCI; ICD-10: F06.7), a risk state for dementia ( 18 ). Notably, among the dementia subtypes, vascular dementias were most frequently recorded as diagnoses , despite dementia in Alzheimer's disease being the most common form of dementia in the population ( 19 ). The MMSE ( 20 ) was performed in 40 patients , and the average MMSE score was lower in patients with a diagnosis of dementia (18.86 ± 5.16) than in those with other diagnoses (22.75 ± 5.01; t (21.7) = 22.23, p = 0.016). As expected, polypharmacy was highly prevalent among the patients referred for consultation, with a median number of 10 different medications . There was, however, no difference in the number of medications as a function of dementia diagnosis or delirium (all p > 0.468). The physicians performing the consultations made a wide range of recommendations . Recommendations regarding pharmacotherapy given most frequently (54.1% of patients). Among these, initiation of novel pharmacological treatment, including medication to be administered as required ( pro re nata , PRN), was most commonly recommended, followed by discontinuation or reduction, and change of medication, which were recommended with equal frequency . Non-pharmacological measures to treat behavioral symptoms were recommended for six patients (9.8%), but it should be noted that assistance with non-pharmacological interventions was primarily provided by the geriatric nurse (C.B.), who interacted with the nursing staff of the participating hospitals largely independently and provided advanced training in non-pharmacological treatment of dementia patients. Across all participating hospitals, consultations were predominantly requested in relation to previously diagnosed or suspected dementia or associated behavioral problems , confirming the need for a dementia-specific consultation service. Other frequent diagnoses included delirium, which is often difficult to distinguish cross-sectionally from dementia ( 1 ), and depressive syndromes, which are an important part of the differential diagnosis, especially in individuals with subjectively reported cognitive symptoms ( 21 ). We note the relatively low number of consultation requests (14.8 %) for patients with a pre-existing confirmed diagnosis of dementia. Although not explicitly stated in the information provided to the referring hospitals introducing the consultation service, our findings suggest that the service was considered to be useful primarily for establishing a new diagnosis, whereas patients who had previously received a diagnosis were likely to be already under regular medical care. Indeed, the predominant reason for requesting a consultation was for diagnosis, with suspected dementia (50.8 %), suspected delirium (24.6 %), and suspected depression (8.2 %) accounting for over three-quarters of the consultation indications. Somewhat unexpectedly, the diagnosis of vascular dementia was the most frequently diagnosed form of dementia during the consultations. Given that dementia due to Alzheimer's disease is the most common form in older adults ( 19 ), we cannot exclude the possibility that some patients diagnosed with vascular dementia may nevertheless have had amyloid pathology and would thus have to be correctly classified as having mixed dementia. This differential diagnosis was, however, difficult to make as part of the consultation and should be performed, for example, in a memory clinic ( 22 ). Alternatively, or more likely additionally, the proportionately high prevalence of vascular dementia in this patient group might reflect local risk profiles. The risk of major cardiovascular disease in Lower Saxony is higher than the average in Germany ( 23 ). Interestingly, however, a study previously conducted in the same region identified an under-diagnosis of Alzheimer's dementia, with a corresponding over-diagnosis of an underlying vascular cause for dementia symptoms ( 24 ). Although a subsequent study found a reduction in the effect over the intervening years, the tendency non-etheless persisted ( 25 ), which may contribute to the proportions among the diagnoses in our cohort. More than 70% of the patients treated were receiving eight or more medications , emphasizing the importance of considering the risks associated with polypharmacy in older patients, and particularly those with dementia, or more generally, cognitive impairment ( 3 , 6 ). Accordingly, in more than 50% of the consultations, an adjustment of pharmacotherapy was recommended, which commonly involved dose reduction or discontinuation, as well as replacement with medication with a more favorable side-effect profile . We note that the number of medications taken by a given patient was independent of patient age, degree of cognitive impairment, and diagnosis reached. Although such dependencies may become apparent in a larger study population, the finding underlines the importance of service provision for this patient group that is not limited to tight criteria but rather is based on communication with colleagues at the partner hospitals. A direct transfer to a (geriatric) psychiatric inpatient unit was recommended in only 11.5% of cases. This low referral rate indicates that acute transfers of people with dementia to psychiatric departments – often associated with great distress for those affected – can possibly be at least partially avoided by providing adequate outreach consultation services. While further neurological or psychiatric assessment was indeed frequently recommended, it can often take place in an outpatient setting. The frequent recommendation of further diagnostic assessment, referral for outpatient neuropsychiatric treatment, or consultation at a memory clinic reflect the fact that dementia and cognitive impairment are chronic conditions that cannot be adequately treated in a single hospital stay. Access to the proposed consultation service meant that these unmet needs could be identified and seamlessly addressed by appropriate specialist facilities following the acute hospital stay, as opposed to requiring a subsequent separate assessment in the community before the necessary referral could be made. Implementing a partnership with external hospitals (partly under private ownership) requires establishment of continuous communication. Individual approaches and intense exchange were essential in building a system of shared patient care. Gaining the interest of potential partners in the project was best achieved through personal contact, preferably on-site. Establishing contact via letter or e-mail remained more challenging, presumably due to the limited time capacities of the respective chief and senior physicians. Once the partnership had been established, it was essential to have fixed contact persons at the respective partner hospitals, who were aware of the possibility of dementia-specific consultations and could both request consultations and distribute information regarding our service. The establishment of a routine with fixed appointments and contact persons proved helpful for regular consultation requests. Telemedical consultations were not possible at all sites due to limited Wi-Fi and other technical factors. The successful implementation of this service in 12 cases, however, provides support for the feasibility of such an approach, which may grow in relevance during the current COVID-19 pandemic as well as future potential pandemics, in which this patient group is at high risk of serious consequences of infection, due to both advanced age and comorbidity. A specialist consultation service can provide diagnostic assessment and treatment plans without increasing social contact and infection risk. Our findings indicate that provision of a dementia-specific consultation service for rurally-based, regional district general hospitals is feasible for university-based geriatric psychiatric units. We suggest that the concept of the dementia consultation service provided by a tertiary referral center (e.g., university hospital) to surrounding regional hospitals may provide a helpful addition to improve care for patients with dementia in rural areas. The service has the potential to reduce acute transfers to in-patient geriatric psychiatry. It enables older patients with dementia or delirium to be treated locally by assisting and empowering rurally-based regional hospitals to manage these problems and associated complications. Future studies are required to provide a more extensive evaluation of these effects. As our project was tailored to meet the capacities and needs of the German healthcare system, future research should also investigate to what extent the concept is transferrable to other geographic regions with comparable organization of hospital care.
|
Review
|
biomedical
|
en
| 0.999996
|
PMC9772834
|
Hypersensitivity pneumonitis (HP) is an immune-mediated interstitial lung disease caused by repeated inhalation of antigens . Accurate antigen identification is fundamental for the diagnosis and management of HP; however, it is often difficult to achieve. To identify the causative antigen, it is important to perform a comprehensive evaluation, including a detailed history of exposure, environmental assessment, response to antigen avoidance, serum antigen-specific antibody testing, and antigen-specific inhalation challenge testing . The presence of serum-specific antibodies against a specific antigen is indicative of previous exposure and immunologic sensitization to that antigen and may increase the probability of HP associated with that antigen . The efficacy of serum antigen-specific antibody testing in the diagnosis of HP has been reported, especially for specific antibodies against avian antigens . Inhalation of aerosolized Mycobacterium avium complex (MAC) from water sources can cause HP, more commonly known as “hot-tub lung” based on its typical source . Although the causative antigens of HP vary by geographic region, a previous report in the USA showed that MAC was the second most common cause of HP after avian antigens, accounting for 28% of patients with the identified antigen . Nevertheless, few studies have examined the efficacy of serum antigen-specific antibody testing in HP associated with MAC. In pulmonary MAC infection, measurement of the levels of serum immunoglobulin A antibody against glycopeptidolipid (GPL) core antigen, a cell surface antigen found in MAC, has been reported to be useful for diagnosis and management [ , , , , ], and its efficacy is mentioned in the British Thoracic Society guidelines for the management of non-tuberculous mycobacterial pulmonary disease . However, little is known regarding its utility in HP associated with MAC. We herein describe the case of a patient in whom inhalation of aerosolized MAC from a whirlpool bath at home caused HP, and the GPL core antibody levels were serially measured from diagnosis to treatment and thereafter. On arrival, his body temperature was 36.4 °C; blood pressure, 120/70 mmHg; pulse rate, 95 bpm; and oxygen saturation, 92% on room air. Physical examination revealed inspiratory crackles in both lungs. Arterial blood gas analysis in room air showed a partial pressure of carbon dioxide of 39.4 mmHg and partial pressure of oxygen (PaO 2 ) of 71.7 mmHg. The white blood cell (WBC) count was within the reference range. The serum levels of C-reactive protein (CRP) (1.61 mg/dL), Krebs von den Lungen-6 , and surfactant protein-D (517.9 ng/mL) were elevated. High-resolution computed tomography (HRCT) of the chest showed diffuse ground-glass opacities with ill-defined centrilobular nodules throughout both lungs with upper lobe predominance, without cavitation, bronchiectasis, or tree-in-bud opacities . Pulmonary function tests showed a restrictive pattern with a decreased predicted value for forced vital capacity (FVC) and decreased predicted value for diffusing capacity of the lung for carbon monoxide (DL CO ) (FVC % predicted, 68.5%; DL CO % predicted, 62.6%). Fig. 1 High-resolution computed tomography (HRCT) images of the lung. (A) HRCT on admission showing diffuse ground-glass opacities with ill-defined centrilobular nodules throughout both lungs with upper lobe predominance. (B) Complete resolution of the abnormalities after 3 months of steroid treatment and discontinuation of the whirlpool bath. Fig. 1 Based on the clinical course and examination findings, the patient was suspected to have non-fibrotic HP associated with potential antigens at home. The patient was admitted for further evaluation and to avoid possible causative antigens present at home. A flexible bronchoscopy was performed. The bronchoalveolar lavage (BAL) fluid showed an elevated total cell count (4.3 × 10 5 /mL) with an increased percentage of lymphocytes (75.0%), and the ratio of CD4 + to CD8 + cells was increased to 5.58. Histopathological examination of the transbronchial lung biopsy specimen revealed alveolitis with infiltration of lymphocytes without granulomas . These results further increased the probability of non-fibrotic HP. Fig. 2 Transbronchial lung biopsy showing alveolitis with infiltration of lymphocytes without granulomas (hematoxylin and eosin, original magnification × 200). Fig. 2 A careful environmental history revealed that the patient had added a whirlpool function to the bathtub when he remodeled his home in October 2020 and had been using it frequently since that winter. Based on his exposure history, aerosols from the whirlpool bath at home, more specifically aerosols containing MAC, were suspected to be the cause of HP. To identify immunologic sensitization to MAC, GPL core antibody levels were measured using an enzyme-linked immunosorbent assay (ELISA) kit (TAUNS Laboratories, Shizuoka, Japan). The antibody level was elevated to 4.22 U/mL and was positive according to a diagnostic cut-off value of 0.7 U/mL for pulmonary MAC infection. The positive result for the GPL core antibody was considered to increase the probability that MAC was the causative antigen; hence, aerosols from the whirlpool bath were the cause of HP. The patient's clinical symptoms gradually improved without treatment within a week of admission. After 2 weeks of hospitalization, his CRP level decreased, and FVC and DL CO improved; however, PaO 2 and radiographic findings did not improve. To determine whether aerosols from the whirlpool bath at home caused HP, we conducted two returning-home provocation tests: one with and one without the use of the whirlpool bath when bathing (showering and simply soaking in the bathtub were performed in both tests). In the returning-home provocation test without the use of the whirlpool bath, no significant changes were observed in his symptoms or examination findings. In contrast, in the returning-home provocation test with the use of the whirlpool bath, the patient developed dyspnea and productive cough 6 h after the use of the whirlpool bath. The following day, the patient had a slight fever, decreased PaO 2 , increased WBC counts and CRP levels, decreased FVC and DL CO , and increased radiographic abnormalities. The returning-home provocation test using the whirlpool bath was considered positive. The patient was advised to discontinue use of the whirlpool bath and was treated with steroids (0.5 mg/kg/day of oral prednisolone) with no antimicrobial therapy. The patient recovered rapidly and was discharged after 26 days of hospitalization. Thereafter, the steroids were tapered over the next 3 months. His symptoms completely resolved, and his laboratory and pulmonary function test results were almost normalized over this period. Repeat chest HRCT after steroid treatment demonstrated complete resolution of the abnormalities . After discontinuing the use of the whirlpool bath, the clinical symptoms and examination findings continued to improve even after the completion of steroid treatment. The patient's clinical course is presented in Table 1 . Despite antigen avoidance during the 2 weeks of hospitalization, the GPL core antibody levels increased from the time of admission. The antibody levels did not vary significantly before and after each of the two returning-home provocation tests. The antibody levels decreased after steroid treatment and discontinuation of the whirlpool bath and remained low even after the completion of steroid treatment. Table 1 Changes in body temperature, laboratory data, and pulmonary function test results. Table 1 Variable Value On admission After 2 weeks of hospitalization (pre-provocation test) Post-provocation test without the use of the whirlpool bath Post-provocation test with the use of the whirlpool bath After 3 months (at the end of steroid treatment) After 6 months Body temperature, °C 36.4 36.5 36.2 37.0 36.4 36.2 PaO 2 , mmHg 71.7 63.0 72.0 64.5 NA NA WBC, /mm 3 9230 6520 7390 19,510 8520 10,060 CRP, mg/dL 1.61 0.12 0.12 3.20 0.26 0.42 FVC, % predicted 68.5 79.1 75.5 53.9 77.8 79.8 DL CO , % predicted 62.6 68.0 NA 58.8 77.6 NA GPL core antibody, U/mL 4.22 8.20 8.49 8.97 1.81 1.93 CRP, C-reactive protein; DL CO, diffusing capacity of the lung for carbon monoxide; FVC, forced vital capacity; GPL, glycopeptidolipid; NA, not available; PaO 2 , partial pressure of oxygen; WBC, white blood cell. First, we found that the GPL core antibody level can be elevated in HP associated with MAC. GPL is a highly antigenic lipid on the surface of the MAC cell wall and is absent in the other major Mycobacterium species, such as M. tuberculosis or M. kansasii . The ELISA kit for measuring the GPL core antibody levels was developed in Japan and is currently used as a diagnostic aid for pulmonary MAC infection. Several studies evaluating the usefulness of the ELISA kit for the diagnosis of pulmonary MAC infection have reported its high specificity, with sensitivity ranging from 52% to 85% and specificity from 91% to 100% at a cut-off value of 0.7 U/mL [ , , , ]. In addition, a multicenter study in Japan showed that the GPL core antibody levels were not elevated in patients whose MAC had merely colonized the respiratory tract . These results suggest that patients with elevated GPL core antibody levels are more likely to have MAC-associated lung diseases. Although most previous reports have validated the GPL core antibody in patients with pulmonary MAC infections, our patient showed that the GPL core antibody level can be elevated even in HP associated with MAC. We are convinced that the diagnosis in our patient was non-fibrotic HP and that the causative antigen was MAC. Based on the diagnostic criteria of the American Thoracic Society, Japanese Respiratory Society, and Asociación Latinoamericana del Tórax clinical practice guideline on the diagnosis of HP in adults , the combination of exposure assessment, HRCT findings, BAL lymphocytosis, and histopathological findings in our patient provided evidence for the definite diagnosis of non-fibrotic HP. In addition, we concluded that MAC was the causative antigen because the provocation test with the use of the whirlpool bath was considered positive, an identical strain of MAC was detected in the BAL fluid and bathtub, and no recurrence was observed after discontinuing the use of the whirlpool bath. One previous report has described the GPL core antibody levels in patients with hot-tub lung . In that report, a married couple was simultaneously affected by hot-tub lung: the husband had elevated GPL core antibody levels, whereas the wife did not. The result observed in the husband supports our finding that the GPL core antibody level can be elevated in HP associated with MAC. However, there is one difference from our patient: the HRCT findings of the husband showed nodular shadows and bronchiectasis, suggestive of the coexistence of MAC infection. Although HP associated with MAC is understood as a condition in which MAC infection and hypersensitivity features can coexist , in our patient, the component of infectious lung disease seemed to be infinitesimal. This is because the HRCT findings of our patient on admission did not show findings suggestive of MAC infection, such as cavitation, bronchiectasis, or tree-in-bud opacities, and the abnormalities completely resolved after antigen avoidance and steroid treatment without antimicrobial therapy. Moreover, although patients with hot-tub lung often present histologically with well-formed granulomas, which are atypical for classic HP and suggestive of concomitant inflammation due to the infectious process , the histopathologic findings in our patient did not show granulomas. To the best of our knowledge, our patient is the first in whom it was shown that the GPL core antibody level was elevated even in inflammation caused by HP alone without an infectious process. In contrast, the wife in the previous report did not show increased GPL core antibody levels. The following possibilities were considered. (1) Other antigens may have caused HP. MAC was not isolated from the respiratory specimen of the wife. Although rare, there have been reports of hot-tub lung caused by antigens other than MAC . (2) The ELISA kit measuring the GPL core antibody may lack sensitivity for the diagnosis of HP associated with MAC, as the sensitivity of this ELISA kit has been reported to be somewhat low in studies of patients with pulmonary MAC infection [ , , , ]. Further studies should be conducted to evaluate the diagnostic accuracy of GPL core antibodies in HP associated with MAC. The presence of GPL core antibodies in patients with HP may increase the probability of MAC being the causative antigen. Therefore, measurement of GPL core antibody levels may help identify the causative antigen of HP. Although HP caused by inhalation of aerosolized MAC is better known as hot-tub lung, it can also occur in areas where hot tubs are not widely available. MAC is a ubiquitous environmental organism, mostly found in water and soil . In living environments, MAC has been found in water systems, such as the water supply, plumbing, bathtubs, and showerheads . MAC can survive, persist, and grow in water systems because it is relatively resistant to high temperatures, adheres to solid substrates in aquatic environments because of its cell surface hydrophobicity, and is highly resistant to disinfectants used in water treatment such as chlorine and ozone . Additionally, MAC is readily aerosolized from water to air owing to its cell surface hydrophobicity . Aerosolization results in the production of particles that contain a high density of MAC that are sufficiently small to enter the human alveoli . Therefore, the combination of a water system inhabited by MAC and the aerosol generation mechanism can cause HP. Although most reports of HP associated with MAC are related to exposure from hot tubs, cases related to exposure from spas, showers, and indoor swimming pools have also been reported . In our patient, the cause was exposure from a whirlpool bath at the patient's home. In addition, an outbreak of occupational HP associated with MAC has been reported among hotel technicians engaged in the maintenance of bath facilities . If aerosol-generating water systems other than hot tubs are the cause of HP, it may be difficult to identify the antigen sources via history examination. The presence of GPL core antibodies in a patient with an unidentified antigen may prompt re-evaluation of the patient's living environment for any overlooked aerosol-generating water systems. Isolation of MAC from respiratory specimens of patients with HP may also increase the probability of MAC being the causative antigen. However, sputum culture was reported to be positive for MAC in only approximately 70% of patients with HP associated with MAC . In addition, although the BAL culture may have a higher isolation rate, bronchoscopy may not be feasible in some situations. Measurement of GPL core antibody levels is highly feasible and may support the diagnosis of HP associated with MAC from a different aspect than isolation of MAC from respiratory specimens. Second, in our patient, GPL core antibody levels decreased with disease improvement. Previous studies on patients with pulmonary MAC infection have reported that GPL core antibody levels were associated with the extent of the disease as seen on imaging and decreased with treatment such as antimicrobial therapy and surgery . These results suggest that the GPL core antibody level may be associated with the bacterial load. Therefore, serial measurements of GPL core antibody levels can be used to monitor disease activity and the therapeutic effect on pulmonary MAC infections. Based on the results in our patient, serial measurements of GPL core antibody levels may be an objective indicator of the therapeutic effect even in HP associated with MAC. Moreover, serial measurements of GPL core antibody levels may help objectively assess whether patients continue to appropriately avoid MAC exposure. In contrast, the GPL core antibody levels did not decrease after 2 weeks of antigen avoidance and did not increase after the provocation test. Thus, measurement of GPL core antibody levels may not be useful as an indicator of the response to short-term antigen avoidance or as a monitoring parameter for provocation testing.
|
Review
|
biomedical
|
en
| 0.999997
|
PMC9797996
|
Lynch syndrome is an abnormal DNA replication function disorder caused by germline variation in the mismatch repair (MMR) gene. In Lynch syndrome families, colorectal cancer, endometrioid adenocarcinoma, and other sites associated with MMR gene abnormalities are prone to early and frequent tumor development ( 1 ). Tumor tissues from patients with Lynch syndrome carry germline variation in the MMR gene and are generally associated with MMR protein expression deficiency (dMMR) and high microsatellite instability (MSI-H). Although rare, the heterogeneous expression of MMR at the protein level has been reported in several papers ( 2 – 4 ). This was manifested by the presence of clear MMR protein-positive expression areas within the regions of MMR expression loss in tumor tissues. They can be classified into four types: clonal, intraglandular, mixed, and isolated, according to the distribution characteristics of the lesions ( 5 ). Classical MMR-loss tumors usually present with MLH1/PMS2 or MSH2/MSH6 co-expression loss with MSI-H and the isolated expression loss of PMS2 or MSH6 with MSI-H,. Additionally, non-classical phenotypes of dMMR with MSI, though rare, have been reported in the literature, mainly in the form of compound loss of MMR protein, loss of canonical expression of MLH1/PMS2 or MSH2/MSH6 with microsatellite stability (MSS) or low microsatellite instability (MSI-L) ( 6 ), and intact expression of the four MMR proteins with MSI-H or MSI-L. The inconsistency between MMR protein expression and MSI in Lynch syndrome-associated tumors has occasionally been reported. Four cases of Lynch syndrome probands admitted to the Rocket Army Specialized Medical Center between 2018 and 2022 were selected. Paraffin-embedded tumor tissues from different sites were collected for MMR protein (MLH1, PMS2, MSH2, and MSH6) detection, MSI detection, MLH1 promoter methylation, next-generation sequencing (NGS), and tumor MMR germline and somatic gene mutation detection. All selected wax blocks were reviewed and confirmed by two senior pathologists, and informed consent was obtained from all selected cases. None of the patients had received radiotherapy, chemotherapy, immunotherapy, or neoadjuvant therapy before surgery. A Roche Bench MarkXT automated immunohistochemistry instrument (Roche Biotechnology Development Co., Ltd., USA) was used for IHC analysis. The two-step EnVision method was used in this study. Primary antibodies (MLH1, PMS2, MSH2, and MSH6) and secondary antibodies were purchased from Roche Biotechnology Development Co. Ltd. Interpretation criteria were as follows: MLH1, PMS2, MSH2, and MSH6 positive signals were located in the nucleus; positively stained tumor and surrounding mesenchymal nuclei were brownish; negatively stained tumor cell nuclei were not stained, and the normal epithelium or mesenchymal tissue surrounding the tumor was brownish. DNA was extracted from the tumor tissue. The DNA concentration and purity were determined using a UV spectrophotometer (PerkinElmer, USA). Sulfite modification and DNA extraction after modification were performed using the EZ DNA Methylation-GoldTM detection kit (ZYMO RESEARCH, USA) according to the manufacturer’s instructions. MLH1 methylation changes were detected using a 7500-fluorescence quantitative polymerase chain reaction (PCR) instrument (Thermo Fisher, USA). Simultaneously, COLO2A1 was used as an internal reference to calculate the relative expression of methylated genes. The primer and probe sequences were as follows: forward, CGTTATATATATCGTTCGTAGTATTCGTGTTT; reverse, CTATCGCCGCCTCATCGT; and probe, 6FAM-CGCGACGTCAAACGCCACTACG-TAMRA. The reaction system was: 5.2 μL of ddH 2 O, 2 μL of modified DNA, 10 μL of Premix Ex TaqTM Hot Start, 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 0.4 μL of the probe to make a total volume of 20 μL. Tumor tissue DNA with a clear positive MLH1 promoter was used as a positive internal control, and triple distilled water was used as a negative internal control. Peripheral blood and primary and metastatic tumor paraffin tissues were collected from the patients, and MMR germline and somatic mutations were detected by NGS whole-exome high-throughput sequencing. Additionally, the MSI status of tumor tissues was evaluated. The detection kits were purchased from Shanghai Kunyuan Gene Technology Co., Ltd. and Beijing Nuohezhiyuan Technology Co., Ltd. DNA extraction, library construction, on-machine sequencing, and data analysis were performed according to the manufacturer’s instructions. NCI 2B3D (BAT25, BAT26, D2S123, D17S250, and D5S346) panels, based on fluorescence quantitative PCR-capillary electrophoresis, were used for primary and metastatic tumor tissue MSI detection. The 2B3D panel was established by the laboratory based on the nucleotide sites and primer sequences recommended by the NCI. Single-nucleotide site detection kits were provided by Microread Gene Technology Co. (Beijing, China). DNA was extracted from normal and tumor tissues and the DNA products were used as templates for PCR amplification. The 2B3D panel reaction products were analyzed by capillary electrophoresis using an ABI3500dx gene sequencer (Thermo Fisher, USA). Single nucleotide site amplification products were detected using a Microread Genetic Analyzer (Microread Genetics Co., Beijing, China). MSI-H was defined as two or more unstable detected sites; MSI-L was defined as one unstable detected site, and MSS was defined as all stable sites. The same experiment was repeated three times using the two methods. The results of the two methods, if consistent six times, were recorded as consistent experimental results, and if inconsistent once, were considered inconsistent experimental results. Case 1, a female patient, 80 years old, with intermittent blood in the stool for 2 years and worsening blood in the stool with increased frequency of stool for more than 2 months. Magnetic resonance imaging exhibited a cauliflower-like mass in the lower rectum with significant narrowing of the intestinal lumen. A large cystic pelvic mass with solid mural nodules was observed, which was closely related to the myometrium at the fundus of the uterus. A large cystic pelvic mass was adherent to the right pelvic wall, right adnexal area, and left adnexal area intraoperatively and was suspected to be of uterine fundus origin. Laparoscopic transabdominal perineal surgery combined with radical rectal cancer surgery, laparoscopic-assisted permanent sigmoid stoma, and laparoscopic pelvic mass resection were performed. A right lower abdominal mass was found 5 months after surgery, which was considered recurrent or metastatic. Therefore, surgical resection was performed. The pathological investigation ( Table 1 ) revealed that the rectal tumor was an invasive moderately differentiated tubular adenocarcinoma, with tumor cells invading the entire intestinal wall and a large number of lymphocytes infiltrating the mesenchyme, and mucinous adenocarcinoma structures could be seen locally . The endometriotic cystic nodule attached to the wall was a clear cell carcinoma, with a microcystic papillary structure and clear or eosinophilic tumor cell cytoplasm, and Hobnail cells could be seen in the glandular lumen . The metastatic mass in the right lower abdomen was also consistent with the morphological and IHC features of clear cell carcinoma; however, the cell grade and proliferation index were significantly higher than that of the primary lesion . Upon immunohistochemistry, MMR proteins showed consistent loss of MSH6 protein expression in the rectal mass , solid mural nodules of endometriotic cysts , and right lower abdominal metastatic mass , and positive PMS2, MSH2, and MLH1 expressions. The rectal mass, solid mural nodules, and right lower abdominal metastatic mass were negative in the MLH1 promoter methylation assay . Pathogenic variations in the germline of intron 7 of the MSH6 gene were detected in the peripheral blood, and the proband of Lynch syndrome was confirmed with family analysis and clinicopathological investigation ( Table 2 ). Pathogenic variations in the MSH6 gene system (c.676G>T) and suspected pathogenic variations in MSH6 were detected in the rectal mass; suspected pathogenic variations in the MSH3 gene (c.190C>G) were detected in the pelvic mass, but no somatic mutations in the MMR gene were detected in the right lower abdominal mass ( Table 2 ). MSI status of primary and metastatic tumor tissues was detected by NCI 2B3D and a single nucleotide locus panel, showing MSI-H in the rectal mass and MSS in both primary and metastatic clear cell carcinoma of the uterus and abdominal wall . A 62-year-old man was admitted to our hospital with intermittent gross painless hematuria for more than 1 month. CTU of the urinary tract revealed an occupying lesion on the left wall of the bladder, left kidney, and left ureter. Colonoscopy revealed a bulging mass in the transverse colon, approximately 43 cm from the anal verge, occupying approximately 1/3 of the intestinal lumen. Laparoscopic radical cystectomy, bilateral ureteral skin fistulas, lymph node dissection, and laparoscopic radical colon cancer surgery were performed. Pathological investigation ( Table 1 ) revealed a high-grade adenomatous polyp with a localized carcinoma (intramucosal carcinoma) in the transverse colon . The bladder mass was a poorly differentiated invasive uroepithelial carcinoma with a "medullary carcinoma" structure, and a large interstitial infiltrate of lymphocyte-dominated inflammatory cells . Upon immunohistochemistry, MMR proteins showed a consistent loss of MSH6 protein expression in the transverse colon mass and bladder mass , with positive PMS2, MSH2, and MLH1 expressions. The transverse colon and bladder masses were negative for MLH1 promoter methylation testing. Germline pathogenic variations in exon 8 of MSH6 were detected in the peripheral blood, and the proband of Lynch syndrome was confirmed with family analysis and clinicopathological investigation ( Table 2 ). Pathogenic mutations in the MSH6 gene system were detected in the transverse colon mass , whereas no somatic mutations in the MMR gene were detected in the bladder mass ( Table 2 ). Different MSI panel assays showed MSI-H in the transverse colon mass and MSI-L in poorly differentiated bladder uroepithelial carcinomas ( Table 3 ). A 57-year-old man was admitted to the hospital with an enlarged right abdominal mass that had persisted for more than 2 months. CT showed a large right intra-abdominal mass with a poorly demarcated liver, right diaphragm elevation, and left mediastinal shift. Additionally, multiple blood-rich lesions were observed in the right perirenal fat capsule, prehepatic fat space, and retroperitoneum. He underwent abdominal exploration, abdominal mass resection, intestinal adhesion release, and tumor resection in the right adrenal region. The patient had also undergone resection of a right chest wall mass 4 years earlier, followed by laparoscopic resection of an occupying adrenal area lesion 2 months later, and radical rectal cancer and pelvic mass 2 years ago. Pathological investigation ( Table 1 ) revealed that the rectal mass was an invasive moderately differentiated tubular adenocarcinoma with invasion of the muscularis propria and massive lymphocytic infiltration of the tumor mesenchyme , which was an adrenal cortical adenocarcinoma with primary and metastatic tumor foci . The tumor in the proximal adrenal region was highly differentiated, the distant metastatic foci were poorly differentiated, and the soft tissue tumor of the chest wall was undifferentiated pleomorphic sarcoma with spindle-shaped and polygonal tumor cells that invaded the striated muscle of the chest wall . Upon immunohistochemistry, MMR proteins showed consistent loss of MSH2 and MSH6 protein expression in the rectal mass , adrenal primary , metastatic mass , and right chest wall mass, with no heterogeneous expression of MMR protein, and positive expression of MLH1 and PMS2. The rectal mass, primary and metastatic adrenal masses, and right chest wall masses were negative for MLH1 promoter methylation. Pathogenic variations in exon 8 of the MSH2 gene were detected in the peripheral blood (copy number variant with copy number deletion of 1.12), and the proband of Lynch syndrome was confirmed with family analysis and clinicopathological investigation ( Table 2 ). Pathogenic systemic mutations in the MSH2 gene and suspected pathogenic mutations in the MSH2 gene were detected in the rectal mass, suspected pathogenic mutations in the MSH6 gene were detected in the adrenal metastatic tumor, MSH6 gene and MLH1 (c.833C>T) with suspected pathogenic mutations, and no somatic mutations in the MMR gene were detected in the adrenal primary mass ( Table 2 ). Different MSI panel assays showed MSI-H for rectal mass, MSI-L for undifferentiated pleomorphic sarcoma of the abdominal wall, MSS for primary adrenocortical carcinoma, and MSI-H for metastatic adrenal carcinoma ( Table 3 ). Pathological investigation ( Table 1 ) revealed that the colon mass was a moderately to poorly differentiated invasive tubular adenocarcinoma with invasion of the serosal layer and massive lymphocytic infiltration of the tumor mesenchyme, with locally visible mucinous adenocarcinoma structures . The right upper arm mass was a histiocytic sarcoma with round, polygonal tumor cells with abundant cytoplasm, large, deep-stained nuclei, obvious nucleoli, and scattered multinucleated tumor giant cells . Upon immunohistochemistry, MMR proteins showed consistent loss of MSH2 and MSH6 protein expression in the colon mass and right upper arm mass , with no heterogeneous expression of MMR protein and positive expression of MLH1 and PMS2. The colon and right upper arm masses were negative for MLH1 promoter methylation. Pathogenic mutations in exon 9 of MSH2 were detected in the peripheral blood ( Table 2 ). Somatic mutations in the MMR gene were not detected in the colonic or right upper arm mass ( Table 2 ). Different MSI panel assays showed MSI-H in the colon mass and MSS in the right upper-arm histiocytic sarcoma ( Table 3 ). No methodological differences in the MSI assay results were observed in any of the cases. There were inconsistencies in MSS between colorectal cancer and extraintestinal tumors in the same patient with germline variations of the MMR gene and loss of MMR protein expression. MSI status may be consistent or inconsistent between extraintestinal primary and metastatic tumors. The consistency between germline variations of MMR genes and loss of MMR protein expression in primary and metastatic tumors outside the intestine did not primarily induce a high degree of MSI in this tumor. The Lynch syndrome is an autosomal dominant disorder caused by germline variations in the MMR gene; the incidence of colorectal cancer, endometrioid adenocarcinoma, and other tumors associated with MMR gene abnormalities is significantly higher in members of the patient's family. IHC analyses for MSH1,PMS2, MSH2, and MSH6 and MSI analysis of the tumor cells are important components of Lynch syndrome screening. Both methods have a high concordance (90%–97.5%) in Lynch-associated colorectal cancer ( 7 ), often revealing the classical MLH1/PMS2, MSH2/MSH6, PMS2, and MSH6 expression deficiency (dMMR) with MSI-H; however, both have a lower concordance in extraintestinal tumors, mostly showing dMMR with an MSI-L/MSS non-classical phenotype ( 6 , 8 , 9 ). Herein, we have reported four cases of the Lynch syndrome proband patients with simultaneous or heterozygous colorectal cancer and extraintestinal tumors (one each undergoing MMR germline and systemic mutation detection, IHC staining for MMR protein expression, or MSI analysis) to reveal the molecular characteristics and correlations of MMR gene mutation, MMR protein expression, and MSI among different tumors in the same patient. In case 1 we observed the patient was diagnosed as the proband of the Lynch family at the age of 80 years; this is significantly older than the age generally observed in cases of the classical Lynch syndrome (≤50 years). Lynch syndrome caused by germline pathogenic variations in MSH6 can have a late onset and is often accompanied by MMS or MSI-L ( 10 ). Because MSH6 variations and loss of protein function mainly cause instability of single-nucleotide microsatellite repeat sequences (accumulation of DNA replication errors), You et al. attributed the dMMR/MSS dMMR/MSI-L (MSI non-classical phenotype caused by MSH6 variations) to the presence of double nucleotide sites in the 2B3D (two single-nucleotide sites and three double-nucleotide sites) MSI assay panel caused by false negatives ( 10 ). To eliminate possible experimental errors due to experimental methods and tumor heterogeneity, we repeatedly validated different paraffin tissues from the same tumor using NCI 2B3D-based and single nucleotide locus panels, respectively, and no differences in the results that were clearly caused by the experimental methods and assay batches were observed. Germline variations in MSH6 (chr2:48032847. c.3646+1G>T (50%)) were detected in the patient's rectal and uterine primary and abdominal metastatic masses. Furthermore, somatic mutations in MSH6 were also detected in the rectal tumors; however, similar somatic mutations were not detected in the extraintestinal tumors, suggesting that differences in the frequency and type of secondary mutation strikes suffered by the MMR gene among different organs may be a potential factor that triggers the atypical phenotype of dMMR and MSI ( 11 , 12 ). In case 2 we observed the patient had a less-differentiated invasive uroepithelial carcinoma with medullary carcinoma features. The patient experienced painless hematuria as the first symptom, and clinical examination revealed a bladder mass. The mass showed a "medullary carcinoma" structure, and a large amount of lymphocyte-based inflammatory cell infiltration was observed in the interstitium; thus, a Lynch syndrome-related tumor was suspected. The diagnosis of the Lynch syndrome was confirmed by IHC staining for the MMR protein, MSI analysis, and germline variation detection of genetically related genes. Further, colonoscopy revealed a colonic mass, and pathological examination revealed a high-grade adenomatous polyp with localized carcinoma. In clinical practice, due to the lack of a clear family history and a history of bowel cancer, Lynch-associated extraintestinal tumors are often diagnosed as conventional sporadic tumors; thus, the opportunity to confirm the diagnosis of the Lynch syndrome is missed. Routine inclusion of MMR protein detection in tumor IHC staining can provide important clues for Lynch screening. An upper uroepithelial carcinoma with an MSH2 germline variant is the most frequent, while bladder cancer is relatively rare, among Lynch-associated uroepithelial tumors ( 13 , 14 ). Skeldon et al. found that patients with Lynch syndrome-associated MMR gene variations are not only prone to uroepithelial cancer, but also have a significantly higher risk of bladder cancer; thus, screening for Lynch-associated tumors should also include a screening for bladder cancer ( 15 ). Ekmekci et al. investigated the relationship between histopathological features and MSI in young patients (under 40 years of age) with uroepithelial carcinomas of the bladder and found that the tumor grade, tumor stage, degree of tumor differentiation, and tumor infiltrative growth pattern had a significant impact on the prognosis; however, they observed that MSI had no effective role in bladder carcinogenesis in these patients ( 16 ). The bladder tumor reported in case 2 was a hypodifferentiated uroepithelial carcinoma with MSH6-expression deficiency and MSI-L. The tumor cells were negative for CK5/6, P63, and P40 and positive for P53 and GATA3; thus, this tumor was a rare type of a uroepithelial carcinoma, but its features were consistent with the typical histological features of Lynch-related tumors. We observed case 3 presented with an isolated, soft tissue, pleomorphic, undifferentiated sarcoma of the chest wall as the first symptom; an occupying lesion was detected in the right adrenal gland 2 months postoperatively following a pathological examination of a highly differentiated adrenocortical adenocarcinoma. Four years postoperatively, another giant abdominal occupancy developed, and the pathology was diagnosed as a recurrent, metastatic, moderate-to-poorly differentiated adrenocortical adenocarcinoma. As both soft tissue sarcomas and adrenal carcinomas are relatively rare Lynch-related tumors, IHC staining for the MMR protein and MSI analysis were not performed in the first two routine pathological examinations. In the third postoperative pathological examination, an IHC staining for the MMR protein was performed, and MSH2/MSH6 expression was found to be absent in the adrenal carcinoma tissue. The tortuous diagnosis of this patient demonstrates the positive role of IHC testing for the MMR protein in the detection of diagnostic clues for the Lynch syndrome. Lynch-associated adrenocortical adenocarcinomas are relatively rare, with an incidence of 3.2% in patients with ACC; this is comparable to the LS-associated prevalence of colorectal and endometrial cancers ( 17 ). Lynch-associated ACC is most commonly associated with MSH2 germline variations, and its MMR protein IHC results are consistent with the germline variation status of the gene, commonly MSS ( 18 ). This is consistent with the test results in this case. In both cases 3 and 4 we observed the patients presented with an extraintestinal, primary soft tissue sarcoma. The sarcoma in case 3 was an undifferentiated pleomorphic sarcoma of the chest wall, while the sarcoma in case 4 was a histiocytic sarcoma of the right upper arm. Sarcomas are rare mesenchymal tumors with marked heterogeneity, accounting for approximately 1% of all malignant tumors in adults. Sarcomas have been reported in patients with LS; these are mainly LS-associated sarcomas with MMR gene variation-carrying tumor tissue and protein-expression deficiencies and Lynch-associated sarcomas without these changes ( 19 ). Lynch-associated soft tissue sarcomas are mostly characterized by MSH2 germline variations; in some cases, patients with these tumors exhibit the Muir–Torre syndrome with multiple cutaneous tumors and an atypical microsatellite phenotype ( 20 ). In our study, all cases were of LS-associated sarcomas and presented with MSH2 germline variations and MSH2/MSH6 protein-expression deficiency; these features are similar to the molecular features of similar tumors reported in the literature ( 21 ). The non-classical phenotype dMMR is closely related to the heterogeneous expression of the MMR protein; the latter is mainly manifested by the simultaneous presence of well-defined MMR protein-positive expression areas within regions of tumor tissue with MMR protein expression deficiency. According to the distribution characteristics, heterogeneous lesions can be classified into four subtypes: clonal, intraglandular, isolated, and mixed. These lesions differ from the lesions that stain unevenly during IHC staining due to issues with staining techniques (such as tissue fixation and preprocessing); they have specific molecular pathological mechanisms and significance. Joost et al. confirmed the existence of heterogeneous MMR-protein expression (as described above) in 14 colorectal cancers; variant expression of antigenic determinant clusters, antigenic expression associated with different differentiation states, secondary mutational strikes occurring in specific tumor clones, and alterations in the tumor microenvironment (such as methylation, hypoxia, and oxidative stress) can lead to the heterogeneous expression of MMR proteins ( 5 ). In our study, clear germline variations in the MMR gene were observed in the four cases, and no methylation of the promoter region of the MLH1 gene was noted. Although secondary mutations (somatic mutations) in the MMR gene existed at different loci among the intestinal, extraintestinal, primary, and metastatic tumors in the same patient, they did not cause a heterogeneous MMR-protein expression; differences were mainly noted in the microsatellite status among tumors at different sites in the intestinal and extraintestinal regions within the same Lynch patients. Inconsistency between the MMR and MSI phenotypes in the tumor tissue from the same site is rare in colorectal cancer but more common in extraintestinal LS-associated tumors. This may be due to false negatives caused by tumor-tissue heterogeneity or a misinterpretation of the IHC staining results for the MMR protein and MSI analysis results. The inconsistency between MMR and MSI phenotypes persisted even after the elimination of experimental errors. Jaffrelot et al. detected 585 cases of dMMR in 4,948 MMR test samples; 89 (15%) of these had non-classical phenotypes (mostly in genetic syndromes and extracolorectal tumors) ( 6 ). Shimozaki et al. reported that the non-classical phenotype of dMMR/MSS was also found in pancreatic cancer in patients with the Lynch syndrome ( 8 ); Latham et al. identified 37 Lynch syndrome-associated tumors with MSS from among 15,045 cases (with 50 types of tumors) ( 9 ); The MSI status of tumor tissue from the same tissue section of the same wax block with an heterogeneous MMR expression region can be clearly heterogeneous. McCarthy et al. used laser microdissection and NGS techniques to analyze the challenges to the interpretation of IHC results and MSI assessment posed by heterogeneous MMR-protein expression; they found that in one case of a colon adenocarcinoma with heterogeneously expressed MLH1 and PMS2, the MLH1/PMS2 expression-preserved region had MSS and the MLH1/PMS2 expression-lost region had high MSI. Furthermore, they identified one MSH6-positive gastric cancer infiltrating lesion with a complete loss of the MSH6 expression in its heterogeneous hyperplastic lesion; however, both regions were MSI-H and had the same MSH6 variant:c.3261delC ( 2 ). The above results confirm that the heterogeneous phenotypes of MMR and MSI in the same tumor tissue may have complex regulatory mechanisms. On the one hand, although the loss of function of The MMR protein caused by molecular events (such as mutation and methylation of the tumor MMR gene) can lead to tumor cells in the MSI-H state, the loss of function of the MMR protein can still be detected by IHC due to the fixed cluster of partial antigenic decisions. On the other hand, tumor subclones with different differentiation states have their own uniqueness at morphological, genetic, epigenetic, or transcriptomic levels, and show heterogeneous expression of MMR proteins with consistent functional and immunophenotypic associations and corresponding MSI states. In addition, there is functional compensation between MMR proteins (PMS2/PMS1, MSH6/MSH3), which can maintain the tumor MSS status in the absence of the four most frequently detected MMR proteins. All atypical dMMR phenotypes reported herein occurred in the extraintestinal tumor tissues, including two cases of soft tissue sarcomas due to germline variations in the MSH2 gene, MSL-L, and MSS. A dMMR inconsistency with MSI was not seen in all primary colorectal cancers; this trend was consistent with the findings of Jaffrelot et al ( 6 ). In this study, we found that the MSI status of LS-associated tumors differed significantly in the same patients with LS with the same MMR germline variation and MMR-protein expression deletion background; colorectal cancers showed more dMMR/MSI-H and extraintestinal tumors showed more dMMR/MSI-L and dMMR/MSS. The molecular mechanism of this non-classical phenotype has not been fully elucidated, but may involve a correlation of MSI with the systemic organ and tissue type. In one study, there were significant organ differences in the proportion MMR protein-expression deficiency coinciding with MSI-H; the proportions were as follows: 94%, colorectal cancer; 71%–87%, endometrioid carcinoma; and 38%–40%, epithelial carcinoma of the upper urinary tract ( 22 ). Kuismanen et al. found that the MSI profiles of colorectal and endometrial cancers differed significantly in patients with LS. In colorectal cancers, the dominant MSI sites contained both coding and non-coding mononucleoside sites; in endometrial cancers, a greater heterogeneity in the MSI sites was noted. Compared with colorectal cancer, endometrial cancer has a lower proportion of MSI loci and a shorter number of allelic shifts at single-nucleotide microsatellite loci ( 23 ). In our study the microsatellite loci characteristics were similar between the LS-associated extraintestinal tumors and endometrial cancer. The MSI analysis panel used in this study, based on the NCI 2B3D and Promega five single-nucleoside loci design, was approved by the National Pharmaceutical Agency and is suitable for tumor MSI detection in the Chinese population. Although these MSI assays were only used for MSI analysis of LS-related colorectal cancer in the early stage, they have now become the mainstream assays for pan-tumor MSI analyses. The results of these method in extraintestinal tumors were highly consistent with those of NGS of multi-MSI sites, indicating that the apparent differences in the MSI-H incidence among different tissues and organs in the context of germline variations of the same MMR gene and MMR protein-expression deletion are objective and not false negatives caused by assay defects ( 24 ). Knudson observed that in hereditary retinoblastoma, germline variations alone are not sufficient to cause tumorigenesis; thus, they inferred that hereditary retinoblastoma involves two types of mutations (a germline variation and a somatic mutation), and proposed the "two-hit doctrine." This doctrine suggests that the second hit may be in the germline variation (one hit) which may be an intragenic mutation, whole-gene deletion, nondisjunction, or somatic recombination of the second allele of the same gene; this would eventually lead to somatic mutation or deletion of the normal allele and affect the cellular MMR system ( 25 ). dMMR crypt lesions were found around MMR protein-deficient adenomas by Ahadova et al. ( 11 ). The normal histological morphology of these lesions suggests that dMMR plays an important role in tumorigenesis. Lynch syndrome-associated CRC is also a sporadic adenomatous polyp in its early stages, and subsequent double-allele mutations and abnormal expression and function of the MMR protein increase the instability and mutational load of tumor-associated gene microsatellites; these then manifest as MSI-H and/or TMB-H, which in turn accelerate tumor development. This suggests that MSI lags behind the development of dMMR. The inconsistency between MMR protein and MSI can be detected when dMMR occurs, and the amount of tandem repeat sequence mutations in tumor cells does not accumulate to MSI ( 11 , 12 ). In the Lynch syndrome, due to heterogeneity of the different organ tumors themselves, when germline variations occur in the MMR gene, there is also an inconsistency in the subsequent somatic mutations in the tumor cells of different tissues and organs. This difference in the frequency, locus, and type of mutations resulting from the superposition of germline and somatic mutations may also be an important reason for the inconsistent MSI status between primary and metastatic tumors of different organs in the same patient. In case 1, a germline MSH6 variation [chr2:48032847. c.3646+1G>T (50%)] was detected in the rectal and uterine primary tumors and lower abdominal metastatic tumors. Furthermore, other somatic mutations of MSH6 were detected in this patient's rectal tumors, suggesting that the frequency and type of secondary mutation strikes may differ among organs, resulting in the atypical phenotype of dMMR and MSI. The mutation rate of microsatellites varies widely among motifs; it is significantly impacted by intrinsic DNA characteristics (gene motif size and sequence as well as the length of gene bundles). This variation is due to differences in the DNA polymerase error rates and in the correction efficiency of MMR gene in repetitive sequences of different sizes and sequences. Thus, the instability of single, dinucleotide, and tetranucleotide markers is generated by different signaling pathways, and multiple genomic maintenance pathways are involved in maintaining MSS ( 26 ). Although the same patients with intestinal, extraintestinal, primary, and metastatic tumors carry the same MMR germline variations and show no significant differences in the MMR protein-expression levels on IHC staining, different somatic secondary mutation sites and types of the MMR gene, polymorphic variants in the gene structure of tissue cells from different organs, and the immune microenvironment may have an impact on the microsatellite status of these cells, thus occurring in the same Lynch patient. The inconsistency in the state of tumor microsatellites among different lesion sites in the same Lynch patient. The complex molecular mechanism underlying this process is unclear and deserves a further in-depth study. In this paper, we have reported four cases of non-classical phenotypes of MSI occurring in primary and metastatic intestinal and extraintestinal tumors in patients with the Lynch syndrome. Unlike the usual heterogeneous expression of the MMR protein occurring within the tumor tissues, these cases stand out for the inconsistency between the absence of an IHC expression of the MMR protein and the microsatellite status of tumor cells, a phenomenon that occurs in the same patient and shows a clear tendency to prefer extraintestinal tumors. Because extraintestinal tumors in Lynch syndrome are not always completely synchronized with colorectal cancer in terms of the time of occurrence, many patients present and operate with isolated extraintestinal tumors only, and it is difficult to confirm the diagnosis by histomorphological analysis alone if the history is incomplete. In the abovementioned four cases, MMR expression was found to be absent during routine MMR-protein testing, and the diagnosis was confirmed by tracing the family history of the tumor and performing additional MSI, MLH1 promoter methylation, and peripheral blood MMR germline variation testing. In addition, because of the low concordance between dMMR and MSI-H in many extraintestinal tumors, when we use the MSI assay as a routine concomitant diagnostic test for pan-tumor immunotherapy, we should refer to both MMR and PDL1IHC assessment and TMB assay results to avoid missing the treatment timing due to the presence of an MSS state in the absence of MMR protein expression.
|
Study
|
biomedical
|
en
| 0.999997
|
PMC9808024
|
Roux-en-Y gastric bypass (RYGB) for the treatment of morbid obesity is still a very prevalent surgery in the world ( 1 ), but with some long-term obesity recurrence rate (about 20 to 30%) ( 2 ). Therefore, some of these patients need surgical reinterventions and conversions. However, the technical complexity of these conversions, with multiple resections and anastomosis, must be considered ( 3 ). Surgical conversion to techniques with greater metabolic power, such as one anastomosis duodenal switch with sleeve gastrectomy (SADI-S), can be effective in this condition, but represents a technical challenge, especially if the gastric pouch of the primary procedure is short ( 4 ). This video article ( link1 ) aims to demonstrate in details some technical modifications in the conversion of RYGB to SADI-S, in a patient with obesity recidivism after RYGB, that makes this procedure simpler and safer, feasible in a single stage, by reducing the number of anastomosis and diminishing its risks and complexity. The surgical team, patient, and trocars positions during the procedure, and the clinical aspects of this case report were recently published ( 5 ). This patient had chronic cholecystitis, and candy cane and had cholecystectomy and candy cane removal during the procedure (not shown in the video). Here we listed the specific steps to perform the conversion of RYGB to SADI-S with gastrogastric jejunal bridge. Watch the video ( link1 ) to visualize the step-by-step described below highlighting the innovative surgical strategy proposal. The Figs. 1 , Fig. 2 , Fig. 3 show the main phases presented in video to perform the conversion of RYGB to SADI-S with Gastrogastric Jejunal Bridge. Fig. 1 Sequence of the laparoscopic conversion of RYGB to SADIs with gastrogastric jejunal bridge. Part 1 – from identification of the gastroentero anastomosis to opening duodenum and ileum. (a) Initial aspect; (b) Transecting gastric remnant at the level of proximal antrum; (c) Gastric remnant after transection; (d) Antrum-jejunal anastomosis; (e) Aspect after antrum-jenunal stapling; (f) Final aspect of Jejuno Antrum Anastomosis; (g) Duodenal first portion dissection; (h) Duodenal transection; (i) Aspect after duodenal transection; (j) Bringing the ileum to the proximal duodenum stump; (k) Initiating posterior layer of duodenum-ileum anastomosis; (l) Finishing posterior layer of duodenum-ileum anastomosis; (m) Opening duodenum and ileum for the anastomosis; and (n) After opening duodenum and ileum; LHL Left Hepatic Lobe; GJ Gastro-Jejunal; A Antrum; J Jejun; D Duodenum; I Ileum; Fig. 1 Fig. 2 Sequence of the laparoscopic conversion of RYGB to SADIs with gastrogastric jejunal bridge. Part 2 – from duodenum-ileum anastomosis to finial aspect of conversion. (a) Initiating anterior layer of duodenum-ileum anastomosis; (b) Final aspect of duodenum-ileal anastomosis (omega anastomosis); (c) Transection of jejunum just distal to jejunal-antrum anastomosis; (d) Aspect after jejunum transection; (e) Resection of jejunal alimentary limb until jejuno-jejunal anastomosis; (f) Jejunal transection at the level of jejunum-jejunal anastomosis; (g) Aspect after jejunal transection at the level of jejunum jejunal anastomosis; (h) Jejunal Bridge; (i) Aspect of jejunum-antrum anastomosis and duodenum-ileal anastomosis; (j) Specimens: jejunum (alimentary limb resected) and gastric remnant (fundus and corpus). A Antrum; J Jejun; D Duodenum; I Ileum; JAL Jejunal Alimentary Limb; JAA Jejunum-Antrum Anastomosis; P Pylorus; B Bulb; DIA duodenum-ileal anastomosis; Fig. 2 Fig. 3 Final Aspects of the laparoscopic conversion of RYGB to SADIs with gastrogastric jejunal bridge. GJ Gastro-Jejunal; DI (duodenum-ileal) Fig. 3 RYGB is a safe and effective surgical procedure in the bariatric field, but presents 20 to 30% of obesity recidivism, in the long term ( 2 ). So, it is essential that we discuss a safe and effective surgical solution for these failures, a scarce topic in the current literature. The decision to convert the RYGB to SADI-S, by videolaparoscopy, was made based in the literature data that shows its greater metabolic potency then RYGB and a very close weight loss results, compared to BPD-DS, with fewer nutritional complications and being technically simpler ( 6 ). The gastrojejunal (GJ) anastomosis of the RYGB was preserved, avoiding adhesions in this region, even in larger gastric pouches ( 7 ). The proximal jejunal alimentary limb from RYGB (8 cm distal to GJ anastomosis) was used as a bridge between the gastric pouch and the antrum, avoiding the gastrogastric anastomosis, which has a significant incidence of fistulas, ulcers and refractory strictures ( 3 , 7 ). The conversion of RYGB to BPD-DS with a hybrid technique has been described in the literature ( 8 ). The lower tension and better vascularization in the jejuno-antral anastomosis probably reduce the risk of anastomotic complications. Cholecystectomy in this patient was performed due to gallstones presence and the “candy cane” was resected, which could be a cause of epigastric pain ( 9 ). The remnant stomach was resected, keeping the distal antrum and pylorus as part of gastric reservoir ( 3 , 8 ). After ensuring the adequate intestinal limb extension, the remnant jejunal alimentary limb was resected, preventing the possibility of bacterial overgrowth ( 10 ). The reimplantation of this hypertrophied alimentary jejunal limb in the intestinal transit was avoided, considering it could compromise weight loss ( 11 ). It was decided to preserve the antral and duodenal arterial arcades, minimizing risks of ischemia in the duodenal-ileal anastomosis ( 12 ). This anastomosis was done in a segment of ileum 300cm from the ICV, a measurement considered a little less effective in terms of weight loss, but nutritionally safer, compared to DS, considering all this segment will function as a common channel ( 13 ). The Petersen space was not closed, taking into account that internal hernias in SADI-S are rare ( 13 , 14 ).
|
Clinical case
|
clinical
|
en
| 0.999996
|
PMC9822544
|
Peripheral myelin protein-22 (PMP22) is mainly expressed in compact myelin of the peripheral nervous system and is an integral membrane glycoprotein of internodal myelin . Conditions associated with PMP22 gene mutations disrupt myelin organization and axonal integrity. With a prevalence of 40 in 100,000 people, autosomal dominant Charcot-Marie-Tooth disease is caused by a heterozygous duplication of chromosome 17p11.2-12 and is the leading inherited peripheral nerve disorder . With a much lower prevalence (7.3 to 16 per 100,000 individuals), hereditary neuropathy with liability to pressure palsies (HNPP) is due to a heterozygous deletion of chromosome 17p11.2 . Usually affecting individuals in the second or third decade, HNPP is marked by episodic, painless, recurrent focal motor and sensory peripheral neuropathy with sensory (numbness) and motor (muscular weakness and atrophy) findings resulting from involvement at potential sites of compression or entrapment such as the median nerve at the wrist, the ulnar nerve at the elbow, and fibular nerve at the fibular neck . When patients present with foot drop, wrist drop, or other mononeuropathies, it is important to look for a history of similar episodes and similar occurrences in other family members. Electrodiagnostic (EDX) studies play a valuable role in diagnosing HNPP as they often demonstrate increased distal motor latencies, prolonged F-wave latencies, and focal slowing of conduction velocities at sites of compression and are normal in other nerve segments . Sensory nerve conduction velocities are often decreased, and sensory nerve action potential amplitudes are usually reduced. A total of 60%-80% of patients with characteristic EDX findings have HNPP confirmation with genetic analysis . Other modalities that may be beneficial in diagnosing HNPP include an ultrasound (US) (showing increased nerve cross-sectional area [CSA] at sites of compression such as wrist [median], elbow [ulnar], and knee [peroneal] and not at non-entrapment sites) and nerve biopsy (revealing tomacular or “sausage”-shaped folded structures of the myelin sheaths with segmental de- and remyelination and varying large-fiber loss) . A 47-year-old male (BMI: 29.53 kg/m 2 ) presented with a three-week history of right foot drop that began while he was recovering from an anterior cervical discectomy and fusion from C4 through C7. The patient had a nine-year history of polyneuropathy. He had a previous episode of foot drop on the right side two years earlier, which improved after 2-3 months. The patient was initially diagnosed with chronic inflammatory demyelinating polyradiculoneuropathy (CIDP) and received intravenous immunoglobulin (IVIG) treatment without benefit. His mother and maternal grandfather had been diagnosed with polyneuropathy, although the cause was not determined. Compound muscle action potentials (CMAP) could not be recorded over the extensor digitorum brevis (EDB) on stimulation of the peroneal nerve bilaterally. The tibial nerves showed decreased motor conduction velocity. No sensory nerve action potentials (SNAP) could be recorded on stimulation of the plantar, superficial peroneal, or sural nerves. Needle EMG revealed fibrillations and positive waves in the right tibialis anterior and peroneus longus with no motor units; the short head of the biceps was normal. The left tibialis anterior and peroneus longus did not show denervation changes. These findings suggested an acute right peroneal nerve neuropathy at the level of the popliteal fossa as well as severe sensorimotor polyneuropathy involving the lower extremities. Stimulation of the right median nerve did not evoke CMAP over the APB and second lumbrical muscles (Table 2 ). The left median nerve revealed marked prolongation of transcarpal motor latency with decreased motor conduction velocity in the forearm segment. No sensory potentials could be recorded on stimulation of the median nerve bilaterally. Stimulation of the ulnar nerves showed slowing of motor conduction across the elbow bilaterally. The CMAPs did not show significant dispersion with proximal stimulation. Needle EMG demonstrated denervation changes in the right APB with no motor units. The left APB was normal. The FDI showed decreased motor unit recruitment and increased polyphasic motor units bilaterally. The EDX studies suggested a severe median nerve neuropathy on the right, but accurate localization was lacking. The findings pertaining to the left median nerve can be explained based on the presence of a diffuse demyelinating neuropathy or by focal slowing at the carpal tunnel along with retrograde slowing from longstanding entrapment at the carpal tunnel. The findings also suggested the additional presence of a bilateral ulnar nerve neuropathy at the elbow with focal demyelination. Since the EDX study findings did not precisely localize the site of the median nerve neuropathy, the patient underwent an US study using a GE LOGIQ machine (GE Healthcare; Chicago, Illinois) with a linear array transducer of 8-18 MHz, according to our lab protocol . The US showed a marked increase in CSA of the median nerve at the carpal tunnel inlet and a significant drop in diameter within the carpal tunnel . An 18-year-old male (BMI: 25.1 kg/m 2 ) presented with a one-week history of sudden onset of right wrist drop. He was using crutches after undergoing surgery for a middle cruciate ligament tear at the knee. On exam, significant weakness of all muscles innervated by the right radial nerve, including the triceps, was noted (Table 1 ). Pinprick sensation was decreased over the dorsal aspect of the right forearm. The right triceps tendon reflex was absent. A right brachial plexus MRI without Gadolinium contrast was normal. The right median nerve showed prolongation of the distal motor latency with decreased motor conduction velocity in the forearm segment; the SNAP showed prolonged latency (Table 2 ). The right ulnar nerve demonstrated a prolonged distal motor latency and decreased motor conduction velocity across the foreman and elbow; the SNAP showed prolonged latency and decreased amplitude. The left median nerve distal motor latency was also prolonged with normal motor conduction in the forearm. The distal motor latency of the left ulnar nerve was prolonged with decreased motor conduction velocity across the elbow. SNAP over the superficial radial nerve showed a low amplitude. The patient’s maternal aunt accompanied him to the neurodiagnostic evaluation. She disclosed that she had experienced episodes of wrist and foot drop. EDX studies on the aunt revealed prolonged distal motor latency and low motor conduction velocity of the right median nerve forearm segment; sensory potentials showed prolonged latency and decreased amplitude. There was also a slowing of motor conduction of the right ulnar nerve across the elbow. The clinical EDX findings and family history suggested the possibility of HNPP, which may have been predisposed to radial nerve palsy due to pressure from the crutches. The underlying pathology was most likely a conduction block in the right radial nerve at or proximal to the innervation of the triceps. A genetic test for PMP22 deletion was subsequently performed, which confirmed HNPP. HNPP is often underdiagnosed or misdiagnosed due to the heterogeneity of the clinical and electrophysiological presentation . Recurrent, often painless episodes of mononeuropathies are a common feature of HNPP. The focal deficits are triggered by physical activity (stretching and repetitive motions of the affected limbs) or extrinsic compression and are believed to be due to a mechanically-induced reversible conduction block, specifically, a failed propagation of action potentials along myelinated nerve fibers . Using axonal excitability techniques, Farrar and colleagues investigated the pathophysiological mechanisms associated with HNPP by stimulating the median motor and sensory axons at the wrist . These authors suggested that axonal hyperpolarization in both motor and sensory axons may contribute to the changes in nerve architecture and that the hyperpolarized resting membrane potential in HNPP may be a significant predisposing factor for developing conduction block with mechanical stresses . Each of the cases in our case series illustrates phenotypical heterogeneity of HNPP, which may have caused the referring physician to miss the diagnosis. Patient #1 illustrates the situation where the patient was initially diagnosed and treated with IVIG for CIDP without benefit. This problem has been previously reported in the literature. Beydoun and colleagues reported two patients who were initially diagnosed and treated for an acquired demyelinating disorder or alternative inherited demyelinating disorder . Upon repeat EDX studies and genetic testing, these patients were accurately diagnosed with HNPP. Distinguishing between HNPP and CIDP is important as the treatment for these conditions is markedly different. Patients with CIDP are often managed with IV or subcutaneous immunoglobulin, corticosteroids, plasma exchange, and newer immunomodulating drugs in refractory cases . Recent reports have made the situation murkier due to the overlapping symptoms and concurrent occurrence. Shah and colleagues described a patient in whom CIDP manifested as neuropathy with liability to pressure palsies and was successfully treated with IVIG . Vrinten and colleagues reported a patient in whom HNPP coexisted with inflammation which responded to immunomodulatory treatment . Liew and Lo described a case of HNPP and painful neuropathy in which the pain was relieved by IVIG . Treatment for HNPP is usually symptomatic and commonly involves physical and occupational therapy to improve fine and gross motor skills, bracing (wrist splint, ankle-foot orthosis), and avoiding activities that pose a risk for pressure palsies such as prolonged sitting with the legs crossed, repetitive movements of the wrist, prolonged leaning on the elbows, and rapid weight loss . The acute neuropathic symptoms associated with HNPP usually resolve within days or weeks. Half of the patients attain a complete recovery, while 10%-15% experience chronic motor deficits following nerve palsies . Patient #2 in our case series presented another unique problem: how to conclusively diagnose CTS in patients with HNPP. EDX studies may not be conclusive in patients with HNPP who show slowing of sensory and motor conduction in median nerves, findings similar to entrapment at the carpal tunnel. US studies may also not provide the answer, as an increase in CSA of nerves at potential entrapment sites is typically seen in HNPP . In this patient, we relied upon the finding of a significant drop in the diameter of the median nerves within the carpal tunnel . US imaging plays an important role in differentiating between HNPP and other demyelinating polyneuropathies, compression neuropathies, and nerve injuries through pattern recognition (US pattern sum score, homogeneity, and entrapment score) . High entrapment ratios (wrist-to-forearm ratio of the median nerve and cubital tunnel-to-upper arm ratio of the ulnar nerve) have been observed in patients with HNPP compared to normal nerve segments between entrapment sites . Furthermore, US is a suitable tool when detecting conditions with non-uniform nerve enlargement . The role of CTR in patients with HNPP is unpredictable . Recovery after CTR is associated with remyelination or nodal reconstruction instead of axonal regeneration, and it is unknown whether PMP22 deletion in HNPP interrupts myelin or nodal reconstitution . Earle and colleagues reported two patients with HNPP who underwent a CTR, both of whom experienced clinical and electrophysiological improvement postoperatively . These authors suggest that patients with HNPP retain the capacity for conduction repair. Patient #2 in our case series underwent both a simultaneous right CTR and right cubital tunnel release. Of note, the potential for pressure palsy is high in patients with HNPP; thus, special precautions such as protective padding over nerves vulnerable to extrinsic pressure were necessary during anesthesia/sedation.
|
Study
|
biomedical
|
en
| 0.999996
|
PMC9877407
|
The spectrum of the diseases associated with neurofascin 186 antibodies is limited mainly to peripheral neuropathy ( 1 ) such as chronic demyelinating inflammatory polyneuropathy ( 2 ) as well as subacute nodopathy ( 3 ) and to amyotrophic lateral sclerosis ( 4 ). Recently, also central nervous system (CNS) involvement in neurofascin 186 autoantibody-associated peripheral neuropathy has been demonstrated ( 5 ). However, cognitive impairment has been rarely reported in association with neurofascin 186 antibodies ( 5 ), and there might be structures in the CNS involved in primary neuroinflammation in the peripheral nervous system. Here we report two patients predominantly presenting with cognitive impairment as a clinical phenotype in which primary neuroinflammatory locus is probably not the peripheral nervous system. Our report thus highlights the novelty of a neurofascin 186 autoantibody-related affectation of the CNS through a possible inflammatory process associated with cognitive impairment. A 75-year-old woman presented complaining of short-term memory disturbances, word-finding difficulties and depressive symptoms starting about a year earlier. She is a multimorbid patient with high care needs. Her comorbidities comprised essential tremor, lung empyema, steatosis hepatis with multiple liver cysts, cholecystolithiasis, coronary heart disease, arterial hypertension, mitral valve insufficiency, hyperlipoproteinemia, hypothyreosis, and polyneuropathy. She also has a knee total endoprothesis on the left and coxathrosis on the right. She also has about 60 pack years involving nicotine abuse, but has probably been abstinent since 2019. Her mother suffered from dementia. She has been categorized as care level two and is about 70% disabled (i.e., severely disabled). Her daughter serves as a complete health care proxy for her. She acquired a secondary school level 1 certificate and worked as a telephone assistant in telecommunications. Concurrent mediation comprised the following: pantoprazole 20 mg/d, atorvastatin 20 mg/d, L-thyroxin 50 mikrog/d, fexofenadin 180 mg/d and bupropion 150 mg/d. Psychopathological examination revealed a loss of drive and a slowed psychomotor speed. Furthermore, she was also suffering from depression (ICD-10: F33.1: recurrent major depression, moderate, Geriatric Depression Scale (GDS) score: 6, i.e., depressive symptoms of mild to moderate severity). Neurological examination demonstrated pallanesthesia in her legs. At cognitive screening, she scored 29 of 30 points on the Mini Mental Status Examination (MMST), but neuropsychological testing revealed an amnestic mild cognitive impairment (MCI) with deficits in information processing speed (attention), visuospatial cognition, verbal and figural memory . Together with cognitive deterioration in multiple domains, a caregiver rating (Bayer Activities of Daily Living Scale, B-ADL) resulted in mild impairments of ADL competence (mean B-ADL: 3.3). Magnetic resonance imaging (MRI) revealed cerebral microangiopathy with Fazekas grade 1. Cerebrospinal fluid (CSF) analysis showed elevated S100 protein (4.7 μg/l, pathological if > 2.7 μg/l) ( Table 1 ) and ptau 181 protein ( Table 1 ). We also identified intrathecal IgG synthesis ( Table 1 ). We also detected anti-neurofascin 186 autoantibodies in serum at 1:32 intensity via anti-neural antigen IgG immunofluorescence testing with BIOCHIP-mosaic with brain tissue and recombinant cells. At follow-up six months later, no serum neurofascin 186 autoantibodies were detectable. Her familiar MCI was evident over the course, but dementia-like syndrome was not. A 66-year-old man presented complaining of memory problems for the past two years. His medical history included nicotine dependency, hyperlipidemia, presbyacusis and post prostate cancer. Psychopathology was indicative of recurrent major depression, moderate (ICD-10: F33.1, Beck Depression inventory (BDI-II) score 31, i.e., depressive symptoms of severe severity). He is married, living with his wife, and has a daughter. He worked as a professional mason. He completed eight years of school and has a secondary school diploma, and has been retired for 3 years. His mother has severe dementia at an age of 87 years and requires constant health supervision. His father died of a myocardial infarction at the age of 46 years. At the time-point of neuropsychological testing, he reported Cognitive screening resulted in mild cognitive impairment (MMST 26/30). At neuropsychological testing, mild difficulties were detected in confrontation naming (language), and more severe cognitive deficits became apparent in information processing speed (attention), phonematic word fluency (language/executive functions), cognitive flexibility (executive functions), visuospatial cognition, working memory, visual memory and partly in verbal memory . His cognitive performance profile was classified as MCI in multiple domains together with mildly reduced ADL-competency (B-ADL: 4.4). His MRI revealed cerebral microangiopathy, but his brain fluorodesoxyglucose positron emission tomography (FDG-PET) yielded pathological Z-scores in the right prefrontal cortex, in the parietal inferior cortex on the right side, lateral occipital cortex on both sides, visual cortex on both sides, and temporal lateral cortex on the right side. Anti-neurofascin 186 autoantibodies were detected in his serum (1: 320) and CSF 1: 32 via anti-neural antigen IgG immunofluorescence testing with BIOCHIP-mosaic with brain tissue and recombinant cells. The neurofascin 186 autoantibodies were still present six months later (1:32). At follow-up he showed speech anomalies primarily entailing a stutter. However, he claims to have already stuttered when young, so that it is not clear whether this should be interpreted as a speech disorder or reactivation. The cognitive disturbances did not appear to be significantly progressive in his follow-up examination. He also denies suffering from hypomimia, vigilance fluctuations, REM sleep disturbances, and hallucinations. Our main finding here is the novelty of CNS involvement in neurofascin 186 antibody-associated autoimmunity over a follow-up of six months in two paradigmatic patients. Neurofascin 186 interacts with Neuropilin-1, which mediates axon guidance and adhesion during the formation of gamma amino butyric (GABA)ergic synapses in the cerebellum ( 6 ). Neurofascin 186 antibodies might have an impact on the function of GABAergic synapses in the cerebellum. Dysfunctional cerebellar GABAergic synapses might in turn affect cognitive functions via functional and anatomical connections between the cerebellum and hippocampus ( 7 ) as a potential mechanism of action of how neurofascin 186 antibodies might act. Another mechanism of action is based on axonal pathology with complement deposition induced by neurofascin 155 and 186 antibodies, which selectively target the nodes of Ranvier in multiple sclerosis ( 8 ). Other reports support the role of neurofascin autoantibodies in demyelinating diseases such as multiple sclerosis ( 9 ). Neurofascin antibodies appear to be much more common in primary progressive multiple sclerosis than in relapsing-remitting multiple sclerosis ( 10 ) ( Table 1 ). These studies suggest that axonal pathology associated with neurofascin 186 autoantibodies may contribute to the progressive course. In one of our patients, we also detected elevated ptau181, suggesting axonal brain damage. Considering the mechanistic studies of how neurofascin 186 autoantibodies might contribute to axonal brain pathology, the ptau181 elevation in one patient can be partially explained. However, axonal pathology in our cases was not caused by multiple sclerosis. The neuroaxonal CNS damage in strategically cognitively relevant areas may contribute to cognitive dysfunction. Mild cognitive dysfunction could also coincide with multiple sclerosis, but further progression to dementia would be entirely atypical for multiple sclerosis. However, the exact mechanism of cognitive dysfunction in association with neurofascin 186 autoantibodies remains unclear in our patients, especially when considering the Bradford-Hill criteria ( 11 ). In our patient 2, it seems unlikely that dysimmune neuropathy and a combined central and peripheral demyelinating syndrome cause the neurofascin 186-associated cognitive dysfunction because of increased brain injury proteins and evidence of intrathecal IgG synthesis suggesting a central inflammatory process. Note that FDG-PET results demonstrate hypometabolism of the frontal, temporal, and parietal lobes in the second patient. Frontotemporal degeneration might therefore be the probable cause of cognitive dysfunction in patient 2, although clinical features for FTD behavioral variant or primary progressive aphasia were not met. In addition, the cognitive impairment began at age 64 years, suggesting possible disease from frontotemporal lobar degeneration. However, the clinical and neuropsychological profiles do not suggest FTD in the second patient. Our follow-up investigations showed persistent neurofascin 186 autoimmunity only in one of the two patients; a peripheral nervous system affectation is also clinically conceivable with persisting neurofascin 186 autoantibodies. Although not formally retested, cognitive impairment was still obvious at follow-up and in both cases. We do not finally know whether autoantibodies against neurofascin 186 play a causal role in cognitive impairment in these two patients. Additionally, both patients suffered from major depression and were positive for cardiovascular risk factors, the latter most probably having caused cerebral microangiopathy found in both MRIs. This might in turn have contributed – at least in parts – to the observed cognitive impairment. Moreover and most interestingly, both patients had a positive family history for dementia. As patient 1 suffered peripheral nerve damage, the presence of neurofascin 186 antibodies should be regarded in conjunction with her peripheral nerve system affectation while considering the main manifestations of neurofascin 186-related disease described so far ( Table 2 : overview of neurofascin 186 antibody-related disease). The main limitation of our case report is that we had no neuropsychological follow-up in either patient. In addition, the origin of MCI in both patients could also be influenced by vascular pathology, as evidenced by cerebral microangiopathy on MRI and the neuropsychological profile showing impairments in several cognitive domains. However, the mild degree of microangiopathy argue against a pronounced vascular pathology as a cause of MCI in these patients. In addition we cannot completely rule out that neurofascin 186 antibodies were false positive in the first case, as these were not replicated six months later. However, the clinically evident severe cognitive impairment and circumstantial evidence for neuroaxonal cell damage in the brain as well as intrathecal IgG synthesis support the possible role of these neurofascin 186 autoantibodies according to the recently published criteria for autoimmune-based psychiatric syndromes ( 12 ). It would be beneficial to measure ptau181 levels in a future study to see whether tau levels normalize over the time course of neurofascin 186-associated cognitive impairment, which we would expect to be the case in autoimmune-mediated cognitive impairment. In the second case, the repeated findings of neurofascin 186 antibodies in addition to brain abnormalities also argue against a false-positive effect of the autoantibody results. Another point worth mentioning is that no patient so far underwent immunotherapy as an individual drug trial, so the we cannot assess any benefit of immunotherapy which would have delivered potential evidence of a possible link between the cognitive impairment and an autoimmune basis of the neurofascin 186 autoantibodies. Our results demonstrate that neurofascin 186 autoantibodies associated with amnestic MCI occur in multiple domains that should be considered in the differential diagnosis for mild cognitive impairment. The strength of this case series is the careful differential diagnosis with a large panel of neural autoantibodies, especially neurofascin 186 autoantibodies, and the longitudinal follow-up in both patients with MCI. Follow-up in both patients with stable cognitive impairment is also suggestive of an autoimmune-mediated time course and reveals no obviously progressive clinical course as in neurodegenerative diseases. These patients have not undergone immunotherapy because of the lack of evidence. More research is needed to investigate the presence of these autoantibodies in association with cognitive impairment in a larger homogeneous cohort without peripheral nervous system involvement and to include comprehensive clinical follow-up to better assess the clinical significance of autoantibody findings.
|
Study
|
biomedical
|
en
| 0.999998
|
PMC9911826
|
Serine threonine kinase (STK11, also shown as liver kinase B1, LKB1) is considered as one of tumor suppressor genes, which encodes for a serine/threonine 11 that activates AMP-activated protein kinase (AMPK), hence being capable of regulating cell response to DNA damage, tumor growth, and energy metabolism ( 1 , 2 ). There have been increasing studies reported that STK11 alterations be associated with primary resistance to immunotherapy agents including anti-programmed cell death protein 1 (anti-PD-1) and its ligand (anti-PD-L1) drugs, which have been emerged as standard first-line treatment with or without cytotoxic drugs (in the circumstance of PD-L1 expression ≥ 50%) in non-small cell lung cancer in absence of targetable mutations ( 3 – 8 ). SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily B, member 1 (SMARCB1, also known as integrase interactor 1, INI1) is also a tumor suppressor gene located in chromosome 22q11.2, expressed in the nucleus of almost all normal tissues of the body ( 9 , 10 ). SMARCB1 is considered to be one of the core subunits of the chromatin remodeling complex SWI/SNF, a subfamily of ATP-dependent chromatin remodeling complexes functioned as involving in chromatin remodeling, dynamic modification of chromatin structure, changing chromatin from dense to open state, thereby controlling gene expression and regulating transcription mechanism proteins ( 11 , 12 ). Mutation of SMARCB1 was frequently presented in sinonasal carcinoma, gastrointestinal cancer, and pancreatic cancer types, however, rarely reported in lung carcinoma ( 13 , 14 ). According to the former literature, cancer patients with pathologic SMARCB1 mutations were reported resulting in a worse prognosis independently from the conventional treatment strategies including chemotherapy, radiation therapy or surgery ( 12 , 15 , 16 ). A 61-year-old Chinese man was admitted to hospital on June 6 th , 2022 with chest distress and slight pain on left chest for approximately three months. He denied smoking or alcohol history, nor any other medical or family disease history. Chest CT on June 6 th , 2022 showed a large space-occupying lesion (size as 8.8 × 5.1 cm) in the superior lobe of left lung, which was closed to mediastinum, presented as obstructive pneumonia, accompanied with vein and artery in left superior pulmonary involvement . In addition, chest CT scan also revealed multiple enlargements of mediastinal lymph nodes . Besides, there was no other distant metastatic lesion detected according to abdomen CT scans and brain MRI findings. Subsequently, he received CT guided percutaneous lung puncture biopsy, results of which revealed dedifferentiated carcinoma most likely originating from lung according to the imaging findings and immunohistochemistry outcomes presented as: TTF-1 (negative), NapsinA (negative), P40 (negative), P63 (negative), CK5/6 (negative), CK(AE1/AE3) (positive), Syn (negative), CgA (negative), CD56 (negative), INI-1 (negative), Ki-67 50% (positive), programmed cell death ligand-1 (PD-L1) negative. Furthermore, via next-generation sequencing (NGS) was performed using tissue sample (tumor cellularity 25%, including 550 cancer-related genes, BIOMED, China) showed STK11 loss, due to the loss of promoter (frequency as 30.67%) and SMARCB1 deficiency, due to p.S67X*10.74% mutations, with a tumor mutational burden (TMB) of 6.85 mutations per megabase, as well as PD-L1 tumor proportion score (22C3) being less than 1%. Based on those, the patient was diagnosed as dedifferentiated lung cancer, with vein and artery in left superior pulmonary involvement, along with metastasis on mediastinal lymph nodes, which was staged as IIIB (cT4N2M0, technically unresectable) according to the criteria of American Joint Committee on Cancer (AJCC) 8 th edition. After the discussion by multi-disciplinary team (MDT, including medical oncologist, surgical oncologist, radiation oncologist, and radiologist), regimen of chemotherapy combined with anti-PD-1 agent was adopted as palliative or neo-adjuvant treatment, which depended on the response status during the drug administration. In addition, maintenance therapy with anti-PD-1 agent should also be taken into consideration after disease control if necessary. Exactly, combined treatment with chemotherapy and immunotherapy has already been recommended as standard choice in advanced NSCLC patients in absence of sensitive targetable mutations. The patient thereby was started on pembrolizumab (200 mg on day 1, every 21 days), and carboplatin/nab-paclitaxel (nab-paclitaxel 260 mg/m 2 on day 1, carboplatin AUC 5 on day 1, every 21 days) as initial treatment. After three cycles′ treatment, restaging chest CT scans showed significant improvement on the primary lesion, as well as metastatic mediastinal lymph nodes . Repeated brain MRI and abdomen CT scans did not suggest any progression disease on other organs either. Efficacy assessment was evaluated as partial response (PR) according to the criteria of Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1. Restaging by the above imaging assessment was resulted in down-staging as cT2N2M0 (IIIA). Based on the downstaging obtained, the patient underwent a radical left upper lobectomy on September 6 th , 2022. Pathologic findings from the surgery confirmed the diagnosis of dedifferentiated lung carcinoma . Immunohistochemistry outcomes were similar to the original biopsy with evidence of immune cell infiltration observed. On October 4 th , 2022, the patient switched to maintenance therapy with pembrolizumab four weeks after the surgery. The only adverse event observed during the treatment was neutropenia (grade 2 according to Common Terminology Criteria Adverse Events version 5.0), which happened after the first cycle exposure of the combined regimen. At the time of manuscript preparation, the patient continues to receive mono-therapy of pembrolizumab, and still maintained an ongoing disease free status. Herein in the present report, we demonstrated a case of dedifferentiated non-small cell lung cancer, characterized by STK11 loss and SMARCB1 deficiency, due to p.S67X mutations, which has been conventionally considered as treatment-refractory, has achieved significantly partial response to neo-adjuvant treatment with pembrolizumab and platinum doublet regimen. To the best of our knowledge, the present case was the first one to report the co-alteration of STK11 loss and SMARCB1 deficiency mutation. Results of the present case highlighted that biomarkers including loss, or SMARCB1 deficiency mutation, might be probably predictive to response to PD-1 blockade therapy. Somatic STK11 mutations were reported presenting in approximately 30% of non-small cell lung cancer patients, especially among smokers ( 17 ). In addition, STK11 mutation often occurred with co-mutation with kirsten ratsarcoma viral oncogene homolog (KRAS) and kelch-like ECH-associated protein 1 (KEAP1), which usually resulted in even worse prognosis ( 18 , 19 ). Most recently, a retrospective study was conducted among USA institutes including the Dana-Farber Cancer Institute/Massachusetts General Hospital, the Memorial Sloan Kettering Cancer Center, and the MD Anderson Cancer Center, to investigate the efficacy prediction role of STK11/KRAS/KEAP1 mutations to immunotherapy efficacy ( 4 ). Results of the observational study showed that STK11 and KEAP1 mutations were associated with significantly worse PFS (STK11 hazard ratio (HR) = 2.04, P < 0.0001; KEAP1 HR = 2.05, P < 0.0001) and OS survival to immunotherapy among KRAS mutant lung adenocarcinoma ( 4 ). Besides, another retrospective research also drew the similar conclusion. CLICaP was a retrospective study performed to evaluate a cohort of Hispanic patients diagnosed with metastatic NSCLC from the US and seven Latin American countries treated with immune checkpoint inhibitors (ICIs) alone or in combination as first-line treatment. Results of the study revealed that OS was significantly shorter for patients carrying STK11 mutations (STK11-mutant 14.2 months versus STK11-wild 27.0 months ) or KEAP1 (KEAP1-mutant 12.0 months versus KEAP1-wild 24.4 months ( P = 0.005)) mutations ( 3 ). Although the potential mechanism still remained uncovered, STK11 has been proposed to induce T-cell exhaustion and immune-suppressed or “cold” tumor microenvironment according to relevant literatures ( 20 ). Nevertheless, there were studies reported that STK11 mutation may be associated with inferior outcomes by combined platinum-doublet plus immunotherapy even in high PD-L1 expression and high TMB patients ( 21 , 22 ). However in the present case, the mutant type of STK11 was presented as the loss promoter of STK11 gene, which may lead to the silence expression of STK11 gene, thereby resulted in function deficiency of tumor suppressor. The difference of the alteration types might stand as one of potential reasons for the diverse clinical outcomes. Besides, the missence of SMARCB1 p.S67X*10.74% mutation may also contribute to the favorable outcomes in the present case, prognosis of which was consistent to a recent study as mentioned before ( 16 ). SMARCB1-deficient carcinoma is a recently recognized entity in several organs, especially reported in sinonasal carcinoma ( 13 , 23 ). Mutation of SMARCB1 deficiency was rarely reported in thoracic neoplasms. It was not until 2018 that Yoshida et al. reported the first case of SMARCB1-deficient pleural squamous cell carcinoma ( 24 ). In that case, patient with SMARCB1-deficient carcinoma of the pleura represented primary resistant to cisplatin plus gemcitabine therapy, thereby progressed rapidly and finally resulted in 10 months OS after diagnosis ( 24 ). Coincidentally, another recent case also reported the characteristics of poor prognosis and chemotherapy resistance in a Chinese patient with lung cancer harboring SMARCB1 deficiency, of which OS presented as 5 months merely ( 25 ). However, there were several studies with limited sample suggested that immunotherapy, including immune checkpoint inhibitors, may present as a promising therapeutic strategy for SMARCB1-deficient tumors, especially in sarcomas, and sinonasal carcinoma ( 26 , 27 ). Mechanistically, SMARCB1 deficiency favored the de-repression of multiple endogenous retroviral elements (ERVs), resulting in cytosolic double-stranded RNA accumulation which activates cytoplasmic sensors including TLR3 and MDA5, and thereby cell-autonomous IFN-α and IFN-λ responses ( 27 ). In addition, an improved anti-cancer innate immune response driven by ERVs de-repression has also been observed in various cancer types ( 28 ), and correlated to response to anti-PD-(L)1 treatment ( 29 ). Practically in the present case, the favorable outcomes of the patient by immunotherapy also suggested that anti-PD-(L)1 treatment might be potentially effective in non-small cell lung cancer patients harboring SMARCB1 deficiency. Comparing to the former results by those published literatures, we speculated that the emerging mutation of STK11 loss (due to the loss of promoter) may play a role on the different outcomes between the present case and former studies. The co-current mutation of STK11 loss and SMARCB1 deficiency may offset the aggressive outcomes by SMARCB1 deficiency, hence resulted in the sensitivity of chemotherapy, as well as anti-PD-1 inhibitors. Even so, further investigation for potential mechanism by basic experiments should still be needed. In addition, because of the limited sample size in the present case report, a larger sample size in real world status should also be necessary to identify the clinical phenomenon. Despite numbers of literatures suggesting the biological plausibility of SKT11 mutation may lead to primary resistant to anti-PD-(L)1 therapy, the issue is far from settled. An exploratory analysis from the trial KEYNOTE-042 revealed that pembrolizumab monotherapy was associated with improved OS when compared with platinum-doublet regardless of STK11 and KEAP1 mutational status ( 30 ). Just be similar to that, we have reported that SKT11 loss co-mutation with SMARCB1 deficiency mutation may also benefit from immunotherapy combined with chemotherapy. Recently, an enhancer of zeste homolog 2 (EZH2) inhibitor tazemetostat, has been approved by Food and Drug Administration (FDA) for the treatment of SMARCB1-deficient epithelioid sarcoma, representing the first molecularly targeted agent for SWI/SNF-deficient malignancies ( 31 ). However, the effectiveness of the target agent on NSCLC patients has not been established yet, which need further identification. Therefore, the combined regimen adopted in the present case might prove some therapeutic thoughts for clinical physicians. In the present report, we demonstrated a case of dedifferentiated non-small cell lung cancer, characterized by STK11 loss and SMARCB1 deficiency mutation that conventionally been considered as treatment-refractory, has achieved significantly partial response to neo-adjuvant treatment with pembrolizumab and platinum doublet regimen. Our case highlighted that either STK11 loss, or SMARCB1 deficiency mutation, might not be used to select patients for PD-(L)1 blockade therapy or chemotherapy, respectively. In addition, awareness and recognition of the co-mutations of STK11 loss and SMARCB1 deficiency mutation may help sharpen focus on effective therapeutic development, and expand our understanding on the potential mechanism, as well as pathological significance of the rare co-mutations.
|
Study
|
biomedical
|
en
| 0.999997
|
PMC9928864
|
Hepatitis delta virus belongs to the genus Deltavirus and was recently reclassified into a new family Kolmioviridae and a new realm called Ribozyviria ( 5 ). HDV has a genome size of 1.7 kilobases (kb) and phylogenetic analyses have distinguished eight genotypes 1–8, which differ by up to 30% in their RNA sequence. Genotype 1 is present worldwide, while genotypes 2–8 were found in more specific geographical areas: HDV-2 and –4 are of Asian origin. HDV-3 is found in South America and HDV-5 to 8 were reported mainly from Africa and more recently in Brazil ( 1 , 6 – 8 ). Cuba is an HBV low prevalence country with a predominance of subgenotype A2 and HBsAg serotype adw2 ( 9 ). Three doses of hepatitis B vaccine are recommended at 2, 4, and 6 months of age and 1 dose for newborns within 24 h of birth. The high vaccination coverage of more than 95% in the study period has led to HBV control, with an incidence rate of 0.5/100.000 population in 2020 ( 10 ). In line with the WHO global strategy of hepatitis elimination by 2030, Cuba has set up a National Strategic Plan for the Prevention and Control of Sexually Transmitted Diseases including viral hepatitis ( 11 ). However, data regarding HDV infection is limited with only one serological study done 32 years ago, when the epidemiological context of HBV infection was very different from today ( 12 ). Therefore, the main aims of our study were to determine the HDV prevalence in Cuban HBsAg carriers and to characterize the HDV strains present in the country. The data were used to assess the possibility of HDV elimination in the Cuban HBV epidemiological setting. Additionally, the study provides reliable information for worldwide HDV prevalence estimates to guide international HBV and HDV control programs toward global elimination. Five hundred and two serum samples received at the National Reference Laboratory of Viral Hepatitis at the Institute of Tropical Medicine Pedro Kouri (IPK) to confirm HBsAg positivity and/or to perform HBV molecular diagnosis between 2006 and 2019 from all over the country were included in this study. The sera had been stored at −20°C and sample information was retrieved from laboratory books or dedicated databases. Two samples had been collected in 2006, 2 in 2007, 9 in 2008, 6 in 2009, 1 in 2011, 37 in 2014, 100 in 2015, 92 in 2016, 143 in 2017, 86 in 2018, and 24 in 2019. Two hundred and ninety-one samples were received from hospitals in Havana (Tertiary Care), 76 sera were from the Eastern, 31 from the Central and 75 from the Western part of Cuba . Twenty-nine samples lacked data about the geographical origin of the patients. In the context of our study, the doctor in charge of a patient with detectable HDV-RNA was informed and a new serum sample for virological follow-up was requested. Viral RNA was extracted from 140 μL of serum using the QIAamp Viral RNA mini kit (Qiagen GmbH, Hilden, Germany). Five μL of RNA were denatured with 45 ng random primers and 10 nmol nucleotides for 5 min at 72°C. Reverse transcription (RT) was then performed for 80 min at 50°C using 200 U SuperScript III reverse transcriptase and 40 U RNaseOUT recombinant RNase inhibitor (Invitrogen, Karlsruhe, Germany) ( 13 ). RT-PCR for HDV detection was done as described previously ( 14 ). Five μL of cDNA were added to TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, United States) as well as 0.5 μM primers and 2.5 μM probe. Fragments for HDV genotyping were amplified using primers 480as, 710s, 1302das, rv900, fw900_2 and 320ds ( 13 ) as well as 1170s (5′-ctcgtcttchhcggtcaacctc-3′, Andernach et al., unpublished). cDNA synthetized as previously described was used with the Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, United States). The PCR was done using 0.8 μM of primers, 0.5 mM of MgCl2 and 0.02 U/μl of the polymerase and the following amplification conditions: 98°C for 30 s, 40× (98°C for 10 s, 54°C for 30 s, 72°C for 60 s) and a final elongation at 72°C for 7 min. In addition, RNA was used with the One step RT-PCR kit (Qiagen GmbH, Hilden, Germany) and 0.5 μM of primers, 1.5 mM of MgCl2 and 1 μl of enzyme mixture per reaction. The cycling conditions were: 50°C for 30 min, 95°C for 15 min, 40× (95°C for 30 s, 54°C for 30 s, 72°C for 60 s) and a final elongation step at 72°C for 10 min. Sequences were edited with SeqScape v2.5 software (Applied Biosystems) and BioEdit Sequence Alignment Editor (version 7.0.9.0, Ibis Biosciences, Carlsbad, CA, United States) and aligned with reference sequences of the 8 HDV genotypes and with similar sequences obtained by BLAST. 1 Phylogenetic analyses were conducted with MEGA version 6 2 and phylogenetic trees were constructed using the neighbor-joining method and the Kimura 2-parameter model. The bootstrap method with 1,000 replications was used as measure of the robustness of each node. Clinically, this patient had compensated liver cirrhosis with portal hypertension with only splenomegaly and esophageal varices grade 1. Serum alanine transaminase (ALT), aspartate transaminase (AST), and gamma-glutamyl transferase (GGT) levels were increased, while the alkaline phosphatase (ALP) and total serum bilirubin (TSB) values were in the normal range. Other hematological and biochemical parameters like creatine, albumin, platelets, and International Normalized Ratio (INR) were also in the normal range. The patient had been under Lamivudine therapy during the last 5 years. After the HDV diagnosis, he received Pegylated Interferon Alpha therapy during 1 year. At the end of the treatment the HDV-RNA and the HBV-DNA were undetectable, while the HBsAg remained positive and the enzymes ALT and AST were in the normal range [median ALT before treatment 117 vs. median post treatment 49 ( p = 0.05), AST: 89 vs. 51 ( p > 0.05)]. The GGT level remained high as a marker of fibrosis. The anti-HDV prevalence found in the present study is very low. In the only other study done in Cuba in 1988, an anti-HDV positivity of 8.3% was detected ( 11 ). While we cannot exclude false positive results in the previous study, the ELISA kit used in the present study is expected to reliably detect HDV antibodies with reported sensitivity and specificity values of above 98% ( 16 ). The difference may be related to the success of the Cuban hepatitis B prevention and control program, since HBV vaccination is the most influential factor concerning the prevalence of both diseases ( 17 ). The vaccination strategy included in the National Immunization Program in 1992 comprised vaccination of all newborn children with the first dose provided in maternity hospitals, as well as vaccination of risk groups to prevent infection before potential exposure. In 2000, a vast vaccination campaign targeting all people less than 20 years of age was done ( 18 ). Therefore, the majority of the Cuban population currently under 40 years old is vaccinated against hepatitis B. After 28 years of nationwide vaccination, the rate of new infections has been drastically reduced ( 10 ). Other measures for HBV control included the screening of all pregnant women, of blood and blood products, the surveillance of children born to HBsAg positive mothers using serological or more recently molecular techniques and education of the population. The considerable reduction of HBV cases may have influenced the HDV epidemiology and thus its currently very low prevalence rate. Consistent global data on the prevalence of HDV are lacking because of different reasons such as lack of testing of HBsAg carriers for HDV infection or non-availability of high quality anti-HDV antibody assays and there are considerable geographical variations ( 3 , 19 , 20 ). Countries in Asia have reported prevalence rates between 4.4 and 60% ( 21 – 23 ), while in sub-Saharan Africa HDV prevalence ranged from 0 to 50% in relation to the clinical picture of the patients ( 12 ). In Europe, the situation is complex because of immigration ( 24 – 27 ) and also countries in the Western world with low HBV prevalence, such as the United States, report diverse HDV prevalence rates ( 28 , 29 ). The Western Amazonia represents one of the places with the highest prevalence of HDV in the world ( 30 ), while other Latin American and Caribbean countries have low prevalence rates ( 31 , 32 ). HDV control or elimination, however, is only possible via successful HBV immunization programs ( 17 ). The interaction between HBV and HDV is complex and multiple virological and host-related factors may be involved. HDV may be temporarily or permanently the dominant virus ( 34 ) and HBV DNA levels are often low or even undetectable in patients with chronic HDV infection ( 33 , 35 ). Also, in the present study both anti-HDV positive cases were HBeAg negative and HBV DNA was undetectable, although the HBV genotype may play a role in the course of chronic hepatitis D. For instance, HBV genotype C has been associated with adverse outcomes (cirrhosis, hepatocellular carcinoma, or mortality) in patients with chronic hepatitis D ( 36 ). In Cuba, HBV genotypes A and D are prevalent ( 9 ). Since these two genotypes seem to have a very different influence on HDV infectivity ( 37 ), it would be interesting to know with which HBV genotype HDV positive patients are infected to anticipate disease outcome. For the HDV-PCR positive patient, RNA was undetectable after 1 year of Interferon treatment and the liver enzymes were normal suggesting a virological and biochemical response. Although this is the first choice of HDV treatment and decreases the HDV viral load in most patients, only 25% of the patients have undetectable levels of RNA afterward ( 1 , 6 , 38 , 39 ). A follow up is needed to verify whether the treatment has a sustained virological response over time, even beyond 24 weeks after treatment suspension ( 1 ). Most patients with HBV/HDV coinfection have high levels of ALT, AST and TSB and maintain a stable condition for a long time before decompensation or hepatic carcinoma occur ( 8 , 33 , 40 ). Disease progression may be influenced by the HDV genotype, with types 1 and 3 being linked to a more severe disease than genotypes 2 and 4 ( 6 , 35 , 40 ).
|
Study
|
biomedical
|
en
| 0.999997
|
PMC9970756
|
The graft inclusion technique is a surgical approach in patients with aortic aneurysm or dissection which was first described by Bentall and De Bono in 1968. 1 Instead of resecting the diseased aortic tissue, it is wrapped around the new prosthesis to achieve better hemostasis. Since this method was prone to pseudoaneurysm formation, it was soon abandoned and—after development of new surgical materials and techniques, including tissue glue—the open graft implantation technique with complete excision of the diseased aorta was adopted. 2 We report the case of a 52- year-old man with a history of aortic valve replacement (AVR) and replacement of the ascending aorta by the graft inclusion technique, suffering from pseudoaneurysm formation causing ascending aortic stenosis (pseudostenosis). A 52-year-old man was brought to the emergency room with dizziness and confusion after collapse. The patient's medical history included two previous cardiac surgical procedures. At the age of 37 years, he underwent mechanical AVR and supracoronary ascending aortic replacement due to congenital aortic valve insufficiency and a 60-mm aneurysm of the ascending aorta. Four years later, the patient underwent an exchange of the prosthetic valve and aortic prosthesis as well as a patch repair of the noncoronary aortic sinus due to prosthetic valve endocarditis and paravalvular leakage. During both operations, the graft inclusion (Bentall) technique was employed (graft inclusion with side-to-side coronary ostial anastomoses). Cardiac catheterization revealed moderate stenosis of the left anterior descending artery necessitating no intervention. During removal of the angiography catheter, a pressure peak gradient of 60 mm Hg was registered approximately 50 mm above the aortic valve level . Synopsis of hemodynamic and imaging data implicated a pseudostenosis of the ascending aorta caused by periprosthetic perfusion via proximal and distal leakages into the perigraft space. In the face of these findings and progressive hemodynamic deterioration, we scheduled the patient for surgical revision of the ascending aorta. Under general anesthesia, an arterial cannula was connected to the right subclavian artery via an 8-mm Dacron prosthesis, followed by median sternotomy. Since there was no safe option for aortic cross-clamping due to severe calcifications of the aorta, the aortic arch and brachiocephalic artery were exposed. Cardiopulmonary bypass was carried out using the ECLS cannulas in the right femoral vein and artery with an additional cannula and tubing inserted through the right subclavian artery, creating two arterial blood circuits: oxygenated blood was administered via right subclavian artery for antegrade cerebral perfusion and via right femoral artery for systemic perfusion. A retrograde cardioplegia catheter was inserted into the coronary sinus, followed by separate cross-clamping of the brachiocephalic trunk and the aortic arch distal to the brachiocephalic trunk. Thus, continuous cerebral and systemic perfusion could be maintained during surgery. The patient was cooled to a tympanic temperature of 28°C. After induction of cardioplegic arrest, the severely calcified graft inclusion was excised, revealing the periprosthetic space filled with fresh blood clots. The ascending prosthesis was excised, and a supracoronary aortic replacement was performed using a 34-mm tube prosthesis. The suture lines were both reinforced with Teflon felt. After termination of cardiopulmonary bypass and removal of the subclavian cannula, femoral venoarterial support was maintained. Due to severe coagulopathy, the chest remained open and was closed 2 days later. The patient could be weaned successfully from extracorporeal membrane oxygenation 3 days after surgery. Postoperative TTE showed normal left ventricular ejection fraction and competent aortic valve prosthesis. After prolonged ventilation due to pneumonia, the patient was weaned from the respirator on postoperative day 10. A postoperative CT scan showed the ascending aorta well reconstructed without any signs of prosthetic leakage or new pseudoaneurysm formation. The patient was discharged in good condition 21 days after surgery . Pseudoaneurysm formation at the site of an aortic anastomosis is a well-known complication after vascular graft implantation. This may also occur following graft inclusion after aortic replacement. 2 Accumulation of blood in the perigraft space is thought to expose anastomotic suture lines to tension, which may eventuate into anastomotic leakage. Previous studies have shown benefits of the full resection technique, as graft inclusion is a significant independent predictor of early and also late mortality, with higher reoperation rates. 3 4 In our case, the diseased aorta used for wrapping the prosthesis was severely calcified. The expanding pseudoaneurysms at the proximal and distal anastomoses resulted in compressive stenosis of the aortic prosthesis, as demonstrated during angiography, where a pressure drop of 100 mm Hg was measured at the site of distal aortic anastomosis. Due to severe calcification of the graft inclusion, the ascending aorta, and the aortic arch, we used both femoral and subclavian access for arterial inflow, with two circuits, allowing us to clamp the noncalcified aortic arch and to induce cardioplegic arrest with a low risk for cerebral embolization. This technique has already been described and performed for aortic hemiarch replacement by Kim et al. 5 Though several organs (liver, kidney, or spinal cord) are known to have a higher tolerance for ischemia compared with brain tissue, it is well-known, that circulatory arrest is associated with an increased risk for postoperative hepatic and renal failure compared with the risk in patients with continuous perfusion. 6 7 Avoiding circulatory arrest could, therefore, improve the patient's recovery by reducing complications like coagulopathy, acute kidney injury, or neurologic events.
|
Clinical case
|
biomedical
|
en
| 0.999998
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.